for the programming language AdenineAdenine programming language chembox verifiedrevid 477242257 ImageFile1 Adenine chemical structure.png ImageSize1 150px ImageFileL2 Adenine 3D balls.png ImageSizeL2 120px ImageFileR2 Adenine 3D vdW.png ImageSizeR2 120px IUPACName 9 H purin 6 amine OtherNames 6 aminopurine ... Hazards Solubility MainHazards FlashPt Autoignition Adenine A , Ade is a nucleobase a purine derivative ... adenine dinucleotide NAD and flavin adenine dinucleotide FAD , and Protein biosynthesis protein synthesis , as a chemical component of DNA and RNA . ref http ghr.nlm.nih.gov ghr glossary adenine Definition of Adenine from the Genetics Home Reference National Institutes of Health ref The shape of adenine is complementary to either thymine in DNA or uracil in RNA . Structure File Adenine numbered.svg thumb left 150px Adenine structure, with standard numbering of positions in red. Adenine forms several ... phase, mainly the 9H adenine tautomer is found. ref cite journal journal Phys.Chem.Chem.Phys. ... cooled adenine investigated by double resonance spectroscopy author Pl tzer, Chr., Kleinermanns, K ..., adenine and 2 chloroadenine, journal Spectrochimica Acta Part A Molecular Spectroscopy volume ... Purine metabolism involves the formation of adenine and guanine . Both adenine and guanine are derived ... acid , as well as fused with the enzyme tetrahydrofolate. In Saccharomyces cerevisiae yeast , the adenine pathway converts P ribosyl PP into adenine through a seven step process. Function Adenine is one ... acid s. In DNA, adenine binds to thymine via two hydrogen bond s to assist in stabilizing the nucleic acid structures. In RNA, which is used for Protein biosynthesis protein synthesis , adenine binds to uracil . Adenine forms adenosine , a nucleoside , when attached to ribose , and deoxyadenosine ..., adenine was sometimes called Vitamin B sub 4 sub . ref cite journal journal Biochem J. year ..., two B vitamins, niacin and riboflavin , bind with adenine to form the essential cofactors nicotinamide ... more details
The Adenine Pathway in yeast is a seven step pathway converting Phosphoribosyl pyrophosphate PRPP to adenine . This product is then either integrated into DNA , RNA , or a ribose diphosphate molecule Adenosine diphosphate ADP , the precursor of Adenosine triphosphate ATP , an essential intermediate storage molecule for most cellular processes. Mechanism The ADE series of enzymes converts the most precursory molecule, PRPP, into adenine by this seven step process. AIR synthetase is ADE 6, and essentially is what closes the five membered ring to form the purine base. class wikitable Molecular precursor Enzyme PRPP none original precursor P ribosylamine ADE4 P ribosylglycinamide ADE5 P ribosylformyl glycinamide ADE8 P ribosylformyl glycinamidine ADE6 P ribosylamino imidazole AIR ADE7 P ribosylamino imidazolecarboxylate CAIR ADE2 P ribosylsuccino carboxamide aminoimidazole SAICAR ADE1 Adenine gallery File Adenine pathway.jpg The molecular formulas of the intermediates. click to enlarge. gallery gallery Deleted image removed Image ade pathway.jpg gallery Mutation Deletion or mutation in Ade2 results in the accumulation of a red precursor in the cells. Colonies formed by such cells would therefore be red. References 1.Montelone, Beth A. Frequently Asked Questions Yeast Strains. Physics Department at Kansas State University. Web. 24 December 2009. http www.phys.ksu.edu gene GENEFAQ.html . Use dmy dates date September 2010 DEFAULTSORT Adenine Pathway Category Biochemistry ... more details
enzyme Name adenine deaminase EC number 3.5.4.2 CAS number 9027 68 3 IUBMB EC number 3 5 4 2 GO code 0000034 image width caption In enzymology , an adenine deaminase EC number 3.5.4.2 is an enzyme that catalysis catalyzes the chemical reaction adenine H sub 2 sub O math rightleftharpoons math hypoxanthine NH sub 3 sub Thus, the two substrate biochemistry substrates of this enzyme are adenine and water H sub 2 sub O , whereas its two product chemistry products are hypoxanthine and ammonia NH sub 3 sub . This enzyme belongs to the family of hydrolase s, those acting on carbon nitrogen bonds other than peptide bonds, specifically in cyclic amidines. The systematic name of this enzyme class is adenine aminohydrolase . Other names in common use include adenase , adenine aminase , and ADase . This enzyme participates in purine metabolism . Structural studies As of late 2007, only one tertiary structure structure has been solved for this class of enzymes, with the Protein Data Bank PDB accession code PDB link 2ICS . References reflist 1 cite journal author Blauch M, Koch FC and Hane ME date 1939 title A study of xanthine oxidase of rat blood journal J. Biol. Chem. volume 130 pages 471&ndash 486 cite journal author Heppel LA, Hurwitz J and Horecker BL date 1957 title Adenine deaminase of Azotobacter vinelandii journal J. Am. Chem. Soc. volume 79 pages 630&ndash 633 doi 10.1021 ja01560a033 issue 3 hydrolase stub Category EC 3.5.4 Category Enzymes of known structure ... more details
PBB geneid 353 Adenine phosphoribosyltransferase is an enzyme that in humans is encoded by the APRT gene . ref name entrez cite web title Entrez Gene APRT adenine phosphoribosyltransferase url http www.ncbi.nlm.nih.gov ... between adenine and phosphoribosyl pyrophosphate PRPP to form Adenosine monophosphate ... Deficiency of APRT in human beings may lead to kidney stones formed of adenine and salts . 2,8 dihydroxy adenine urolithiasis 2,8 Dihydroxy adenine urolithiasis is also known as adenine phosphoribosyltransferase deficiency . Adenine phosphoribosyltransferase APRT deficiency is an uncommon genetic ... truly is. Patients with the disease deficiency lack the enzyme adenine phosphoribosyltransferase ..., Yoshida O title A case of a compound heterozygote for adenine phosphoribosyltransferase deficiency ... 10.1007 BF01014193 cite journal author Johnson LA, Gordon RB, Emmerson BT title Adenine phosphoribosyltransferase ... for almost all defective alleles causing adenine phosphoribosyltransferase deficiency in Japanese patients ... missense mutation in the adenine phosphoribosyltransferase APRT gene from five Icelandic patients ... common to the type I adenine phosphoribosyltransferase deficiency in Japanese subjects journal Am. J ... analysis of human mutant adenine phosphoribosyltransferase genes the nature and frequency of errors ... al. title Identification of a splice mutation at the adenine phosphoribosyltransferase locus in a German ... enzyme for a special type of adenine phosphoribosyltransferase APRT deficiency by sequence specific ... pmc 1683345 cite journal author Hidaka Y, Tarl SA, Fujimori S, et al. title Human adenine phosphoribosyltransferase ... cite journal author Wilson JM, O Toole TE, Argos P, et al. title Human adenine phosphoribosyltransferase ... cite journal author Hidaka Y, Palella TD, O Toole TE, et al. title Human adenine phosphoribosyltransferase ... GF, et al. title Analysis of germline and in vivo somatic mutations in the human adenine phosphoribosyltransferase ... cite journal author Sahota A, Chen J, Boyadjiev SA, et al. title Missense mutation in the adenine phosphoribosyltransferase ... more details
for the nucleic base AdenineAdenine Notability date February 2011 Adenine , named after the nucleobase adenine , is a scripting language that is cross platform , which is developed in the context of project Haystack MIT project Haystack and Project Oxygen of the Massachusetts Institute of Technology MIT Computer Science and Artificial Intelligence Laboratory CSAIL in collaboration with Nippon Telegraph and Telephone NTT . A substantial characteristic of Adenine is that this language possesses native support for the Resource Description Framework RDF . The language constructs of Adenine are derived from Python programming language Python and Lisp programming language Lisp . Adenine is written in RDF and thus also can be represented and written with RDF based syntaxes such as Notation3 N3 . Also, as well as RDF, Adenine can be extended. The data type system corresponds to the data type system from RDF and XML Schema, and can be extended. External links http haystack.csail.mit.edu developers adenine.html Adenine tutorial PDF http groups.csail.mit.edu haystack documents papers 2002 sow2002 adenine.pdf Adenine A Metadata Programming Language 17.3 KB Overview of Adenine PDF http web.archive.org web 20060902101312 http haystack.lcs.mit.edu documentation adenine.pdf Metadata Programming in Adenine Draft More detailed explanation of Adenine and its usage. http www.ifcx.org wiki Adenine.html Adenine page at IFCX.org Category Semantic Web Category RDF data access Category Scripting languages Category Extensible syntax programming languages Category Data structured programming languages Category Dynamic programming languages Category Statically typed programming languages both static and dynamic Category Functional languages Category Lisp programming language family Category Multi paradigm programming languages Category Object oriented programming languages Category Term rewriting programming languages de Adenine ... more details
Infobox Disease Name Adenine phosphoribosyltransferase deficiency Image Dihydroxyadenine.png Caption Dihydroxyadenine, an insoluble purine DiseasesDB 32632 ICD10 ICD10 E 79 e 70 ICD9 ICD9 277.2 ICDO OMIM 102600 MedlinePlus eMedicineSubj eMedicineTopic MeshName MeshNumber Adenine phosphoribosyltransferase deficiency also called APRT deficiency or 2,8 dihydroxyadenine urolithiasis is an autosome autosomal dominance genetics recessive ref name pmid8976113 cite journal pmid 8976113 year 1996 month December author Kamatani, N title Adenine phosphoribosyltransferase APRT deficiency volume 54 issue 12 pages 3321 7 issn 0047 1852 journal Nippon rinsho. Japanese journal of clinical medicine url http toxnet.nlm.nih.gov cgi bin sis search r?dbs hsdb term rn 315 30 0 format Free full text ref metabolic disorder associated with a mutation in the enzyme adenine phosphoribosyltransferase . ref name pmid8825602 cite journal doi 10.1111 j.1399 0004.1995.tb04098.x pmid 8825602 year 1995 month November author Terai, C Hakoda, M Yamanaka, H Kamatani, N Okai, M Takahashi, F Kashiwazaki, S title Adenine phosphoribosyltransferase deficiency identified by urinary sediment analysis cellular and molecular confirmation volume 48 issue 5 pages 246 50 issn 0009 9163 journal Clinical genetics ref Characteristics The disorder results in accumulation of the insoluble purine 2,8 dihydroxyadenine . ref name pmid11138609 cite journal pmid 11138609 year 2000 month author Funato, T Nishiyama, Y Ioritani, N Matsuki, R Yoshida, K Kaku, M Sasaki, T Ideguchi, H Ono, J title Detection of mutations in adenine phosphoribosyltransferase APRT deficiency using the LightCycler system volume 14 issue 6 pages 274 9 issn 0887 ... adenine phosphoribosyltransferase and therefore have difficulties breaking down dietary substances ... with this hair color. Genetics Image Autorecessive.svg thumb right Adenine phosphoribosyltransferase ... can cause reddish brown diaper spots. References reflist External links RareDiseases 546 Adenine ... more details
protein Name solute carrier family 25 mitochondrial carrier adenine nucleotide translocator , member 4 caption image width HGNCid 10990 Symbol SLC25A4 AltSymbols PEO3, PEO2, ANT1 EntrezGene 291 OMIM 103220 RefSeq NM 001151 UniProt P12235 PDB ECnumber Chromosome 4 Arm q Band 35 LocusSupplementaryData protein Name solute carrier family 25 mitochondrial carrier adenine nucleotide translocator , member 5 caption image width HGNCid 10991 Symbol SLC25A5 AltSymbols ANT2 EntrezGene 292 OMIM 300150 RefSeq NM 001152 UniProt P05141 PDB ECnumber Chromosome X Arm q Band 24 LocusSupplementaryData q26 protein Name solute carrier family 25 mitochondrial carrier adenine nucleotide translocator , member 6 caption image width HGNCid 10992 Symbol SLC25A6 AltSymbols ANT3 EntrezGene 293 OMIM 403000 RefSeq NM 001636 UniProt P12236 PDB ECnumber Chromosome Y Arm p Band LocusSupplementaryData Adenine nucleotide translocator ANT also known as the adenosine diphosphate ADP Adenosine triphosphate ATP translocator is a mitochondrial protein. Function ANT has long been thought to function asymmetrically as a homodimer of subunits in the inner mitochondrial membrane. The dimer was thought to be a gated pore through which ADP and ATP were exchanged between the mitochondrial matrix and the cytoplasm. The dimer hypothesis was first challenged when the three dimensional structure of ANT was discovered to be a monomer. ref name pmid14603310 cite journal author Pebay Peyroula E, Dahout Gonzalez C, Kahn R, Tr z guet V, Lauquin GJ, Brandolin G title Structure of mitochondrial ADP ATP carrier in complex with carboxyatractyloside journal Nature volume 426 issue 6962 pages 39 44 year 2003 month November pmid 14603310 doi 10.1038 nature02056 url issn ref Further work has shown that ANT functions a monomer in detergents ... express in liver See also mitochondrial carrier Footnotes Reflist External links MeshName Adenine Nucleotide Translocator 1 MeshName Adenine Nucleotide Translocator 2 MeshName Adenine Nucleotide Translocator ... more details
ring that carries the adenine Moiety chemistry moiety . In plants In photosynthetic organisms, NADPH ... See also Nicotinamide adenine dinucleotide Enzyme cofactors References Reflist DEFAULTSORT Nicotinamide Adenine Dinucleotide Phosphate Category Nucleotides Category Coenzymes bg ca Nicotinamida ... nicotinamida e adenina ru simple Nicotinamide adenine dinucleotide ... more details
adenine dinucleotide , abbreviated NAD sup sup , is a coenzyme found in all living cell biology ... groups. One nucleotide contains an adenine base and the other nicotinamide . In metabolism ... form. Some NAD is also converted into nicotinamide adenine dinucleotide phosphate NADP the chemistry .... Physical and chemical properties further2 Redox Nicotinamide adenine dinucleotide, like all dinucleotide ... s consist of ribose rings, one with adenine attached to the first carbon atom the Nucleic acid nomenclature ... left 250px The redox reactions of nicotinamide adenine dinucleotide. In metabolism, the compound accepts ... strongly absorb ultraviolet light because of the adenine. For example, peak absorption of NAD is at a wavelength ... N, Shibata T, Osago H, Tsuchiya M title The simultaneous measurement of nicotinamide adenine dinucleotide ... forms of nicotinamide adenine dinucleotide is called the NAD NADH ratio. This ratio is an important ... adenine dinucleotide in the cytoplasm and mitochondria of rat liver journal Biochem. J. volume 103 ... SJ, Guarente L title Nicotinamide adenine dinucleotide, a metabolic regulator of transcription, longevity ... pmid 12648681 doi 10.1016 S0955 0674 03 00006 1 ref In contrast, the Nicotinamide adenine dinucleotide ... adenine dinucleotide phosphate in the cytoplasm of rat liver journal Biochem. J. volume 115 issue ... 16698895 ref ref Cite journal author Foster JW, Moat AG title Nicotinamide adenine dinucleotide ... acid adenine dinucleotide NaAD . Finally, the nicotinic acid moiety in NaAD is amide amidated to a nicotinamide Nam moiety, forming nicotinamide adenine dinucleotide. ref name Belenky In a further ... ref Nicotinamide adenine dinucleotide has several essential roles in metabolism . It acts ... ref Since both the oxidized and reduced forms of nicotinamide adenine dinucleotide are used in these linked ... Nicotinamide adenine dinucleotide metabolism as an attractive target for drug discovery journal ... S, Wang J, Kaneko M, et al. title Protecting axonal degeneration by increasing nicotinamide adenine ... more details
A phosphoribosyltransferase is a type of transferase enzyme. Types include Adenine phosphoribosyltransferase Hypoxanthine guanine phosphoribosyltransferase Orotate phosphoribosyltransferase Uracil phosphoribosyltransferase Glycosyltransferases Category Transferases enzyme stub ... more details
class wikitable Mutation number Nucleotide change Position base pair Total size base pair s Position Forward 5 3 Reverse 5 3 M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc M3 M4 M8 M9 M15 M17 M20 M33 M35 M38 M40 M42 M45 M52 M55 M57 M60 M64.1 M75 M89 M91 M94 M95 M96 M105 M122 M124 M130 M131 M132 M139 M145 M168 M170 M172 M173 M174 M175 M176 M179 M201 M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg M241 Guanine G to Adenine A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M242 Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt M258 M267 Thymine T to Guanine G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M268 M269 M285 Guanine G to Cytosine C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M286 Guanine G to Adenine A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M287 Adenine A to Thymine T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M297 M299 M304 Adenine A to Cytosine C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt M306 M335 Thymine T to Adenine A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta M339 Thymine T to Guanine G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt M340 Guanine G to Cytosine C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa M342 Cytosine C to Thymine T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact M343 Cytosine C to Adenine A 402 424 tttaacctcctccagctctgca acccccacatatctccagg M347 M349 Guanine G to Thymine T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct M356 M359 Thymine T to Cytosine C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt M365 Adenine A to Guanine G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M367 Adenine A to Guanine G 196 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M368 Adenine A to Cytosine C 200 274 ccttcatttaggctgtagctgc tgtatctttagttga ... more details
Refimprove auto yes date December 2009 Image Cytosine chemical structure.png Cytosine 100px right Cytosine Image Thymine chemical structure.png Thymine 100px right Thymine Image Uracil chemical structure.png Uracil 100px right Uracil Image Adenine chemical strucfture.png Adenine 100px right Adenine Image Guanine chemical structure.png Guanine 100px right Guanine A nitrogenous nitrogen containing base is a nitrogen containing molecule having the chemical properties of a base. It is an organic compound that owes its property as a Base chemistry base to the lone pair of electron s of a nitrogen atom . In biological science s, nitrogenous bases are typically classified as the derivatives of two parent compounds, pyrimidine and purine . ref Nelson and Cox 2008, p. 272. ref They are non polar and due to their aromaticity , planar. Both pyrimidines and purines resemble pyridine and are thus weak bases and relatively unreactive towards electrophilic aromatic substitution . ref Carey 2006, p. 1206. ref Their flat shape is particularly important when considering their roles in nucleic acids as nucleobase s building blocks of DNA and RNA adenine , guanine , thymine , cytosine , and uracil . These nitrogenous bases hydrogen bond between opposing DNA strands to form the rungs of the twisted ladder or double helix of DNA or a biological catalyst that is found in the nucleotides. Adenine is always paired with thymine, and guanine is always paired with cytosine. Uracil is only present in RNA replacing thymine and pairing with adenine. Notes Reflist References Nelson, David L. and Michael M. Cox 2008 . Principles of Biochemstry , ed. 5, W.H. Freeman and Company. Carey, Francis A. 2008 . Organic Chemistry , ed. 6, Mc Graw Hill. DEFAULTSORT Nitrogenous Base Category Biochemistry Biochemistry stub ar ca Base nitrogenada es Base nitrogenada eo Nitrogena bazo gl Base nitroxenada lt Nukleobaz pt Base nitrogenada th tr Azotlu baz zh ... more details
enzyme Name mannuronate reductase EC number 1.1.1.131 CAS number 37250 62 7 IUBMB EC number 1 1 1 131 GO code 0050090 image width caption In enzymology , a mannuronate reductase EC number 1.1.1.131 is an enzyme that catalysis catalyzes the chemical reaction D mannonate NAD P math rightleftharpoons math D mannuronate NAD P H H sup sup The 3 substrate biochemistry substrates of this enzyme are D mannonate , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 4 product chemistry products are D mannuronate , nicotinamide adenine dinucleotide NADH , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup . This enzyme belongs to the family of oxidoreductase s, specifically those acting on the CH OH group of donor with NAD or NADP as acceptor. The systematic name of this enzyme class is D mannonate NAD P 6 oxidoreductase . Other names in common use include mannonate dehydrogenase , mannonate nicotinamide adenine dinucleotide , phosphate dehydrogenase , mannonate dehydrogenase , mannuronate reductase , mannonate dehydrogenase NAD P , D mannonate nicotinamide adenine dinucleotide phosphate , and oxidoreductase D mannuronate forming . References reflist 1 cite journal author Farmer JJ 3rd Eagon RG date 1969 title Aldohexuronic acid catabolism by a soil Aeromonas journal J. Bacteriol. volume 97 pages 97 106 pmid 4388117 issue 1 pmc 249554 1.1.1 enzyme stub Category EC 1.1.1 Category NADPH dependent enzymes Category NADH dependent enzymes Category Enzymes of unknown structure it Mannuronato reduttasi ja ... more details
enzyme Name 21 hydroxysteroid dehydrogenase NADP EC number 1.1.1.151 CAS number 37250 76 3 IUBMB EC number 1 1 1 151 GO code 0047008 image width caption In enzymology , a 21 hydroxysteroid dehydrogenase NADP EC number 1.1.1.151 is an enzyme that catalysis catalyzes the chemical reaction pregnan 21 ol NADP sup sup math rightleftharpoons math pregnan 21 al NADPH H sup sup Thus, the two substrate biochemistry substrates of this enzyme are pregnan 21 ol and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 3 product chemistry products are pregnan 21 al , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup . This enzyme belongs to the family of oxidoreductase s, specifically those acting on the CH OH group of donor with NAD or NADP as acceptor. The systematic name of this enzyme class is 21 hydroxysteroid NADP 21 oxidoreductase . Other names in common use include 21 hydroxy steroid dehydrogenase , 21 hydroxy steroid nicotinamide adenine dinucleotide phosphate , dehydrogenase , 21 hydroxy steroid dehydrogenase nicotinamide adenine dinucleotide , phosphate , NADP 21 hydroxysteroid dehydrogenase , and 21 hydroxysteroid dehydrogenase NADP . References reflist 1 cite journal author MONDER C, WHITE A date 1965 title THE 21 HYDROXYSTEROID DEHYDROGENASES OF LIVER. A NICOTINAMIDE ADENINE DINUCLEOTIDE PHOSPHATE DEHYDROGENASE AND TWO NICOTINAMIDE ADENINE DINUCLEOTIDE DEHYDROGENASES journal J. Biol. Chem. volume 240 pages 71&ndash 7 pmid 14253469 1.1.1 enzyme stub Category EC 1.1.1 Category NADPH dependent enzymes Category Enzymes of unknown structure it 21 idrossisteroide deidrogenasi NADP ja 21 NADP ... more details
enzyme Name FAD diphosphatase EC number 3.6.1.18 CAS number 37289 30 8 IUBMB EC number 3 6 1 18 GO code 0047884 image width caption In enzymology , a FAD diphosphatase EC number 3.6.1.18 is an enzyme that catalysis catalyzes the chemical reaction FAD H sub 2 sub O math rightleftharpoons math AMP FMN Thus, the two substrate biochemistry substrates of this enzyme are FAD and water H sub 2 sub O , whereas its two product chemistry products are adenosine monophosphate AMP and flavin mononucleotide FMN . This enzyme belongs to the family of hydrolase s, specifically those acting on acid anhydrides in phosphorus containing anhydrides. The systematic name of this enzyme class is FAD nucleotidohydrolase . Other names in common use include FAD pyrophosphatase , riboflavin adenine dinucleotide pyrophosphatase , flavin adenine dinucleotide pyrophosphatase , riboflavine adenine dinucleotide pyrophosphatase , and flavine adenine dinucleotide pyrophosphatase . This enzyme participates in riboflavin metabolism . References reflist 1 cite journal author Ravindranath SD, Rao NA date 1969 title Nucleotidases in plants. 3. Effect of metabolites on the enzyme hydrolyzing flavine adenine dinucleotide FAD from Phaseolus radiatus journal Arch. Biochem. Biophys. volume 133 pages 54&ndash 9 pmid 5810832 doi 10.1016 0003 9861 69 90487 1 issue 1 cite journal author Shin HJ, Mego JL date 1988 title A rat liver lysosomal membrane flavin adenine dinucleotide phosphohydrolase purification and characterization journal Arch. Biochem. Biophys. volume 267 pages 95&ndash 103 pmid 2848456 doi 10.1016 0003 9861 88 90012 4 issue 1 hydrolase stub Category EC 3.6.1 Category Enzymes of unknown structure ... more details
DISPLAYTITLE C sub 5 sub H sub 5 sub N sub 5 sub The molecular formula C sub 5 sub H sub 5 sub N sub 5 sub may refer to Adenine 2 Aminopurine MolFormDisambig sr C5H5N5 ... more details
Pentosyltransferases are a type of glycosyltransferase that catalyze the transfer of a pentose . Examples include adenine phosphoribosyltransferase hypoxanthine guanine phosphoribosyltransferase pertussis toxin poly ADP ribose polymerase They are classified under Enzyme Commission number EC number 2.4.2. External links MeshName Pentosyltransferases Glycosyltransferases enzyme stub Category EC 2.4.2 ... more details
enzyme Name 21 hydroxysteroid dehydrogenase NAD EC number 1.1.1.150 CAS number 37250 75 2 IUBMB EC number 1 1 1 150 GO code 0047007 image width caption In enzymology , a 21 hydroxysteroid dehydrogenase NAD EC number 1.1.1.150 is an enzyme that catalysis catalyzes the chemical reaction pregnan 21 ol NAD sup sup math rightleftharpoons math pregnan 21 al NADH H sup sup Thus, the two substrate biochemistry substrates of this enzyme are pregnan 21 ol and nicotinamide adenine dinucleotide NAD sup sup , whereas its 3 product chemistry products are pregnan 21 al , nicotinamide adenine dinucleotide NADH , and hydrogen ion H sup sup . This enzyme belongs to the family of oxidoreductase s, specifically those acting on the CH OH group of donor with NAD or NADP as acceptor. The systematic name of this enzyme class is 21 hydroxysteroid NAD 21 oxidoreductase . This enzyme is also called 21 hydroxysteroid dehydrogenase NAD . References reflist 1 cite journal author MONDER C, WHITE A date 1965 title THE 21 HYDROXYSTEROID DEHYDROGENASES OF LIVER. A NICOTINAMIDE ADENINE DINUCLEOTIDE PHOSPHATE DEHYDROGENASE AND TWO NICOTINAMIDE ADENINE DINUCLEOTIDE DEHYDROGENASES journal J. Biol. Chem. volume 240 pages 71&ndash 7 pmid 14253469 1.1.1 enzyme stub Category EC 1.1.1 Category NADH dependent enzymes Category Enzymes of unknown structure it 21 idrossisteroide deidrogenasi NAD ja 21 NAD ... more details
enzyme Name purine imidazole ring cyclase EC number 4.3.2.4 CAS number 95990 28 6 IUBMB EC number 4 3 2 4 GO code 0050230 image width caption In enzymology , a purine imidazole ring cyclase EC number 4.3.2.4 is an enzyme that catalysis catalyzes the chemical reaction DNA 4,6 diamino 5 formamidopyrimidine math rightleftharpoons math DNA adenine H sub 2 sub O Hence, this enzyme has one substrate biochemistry substrate , DNA 4,6 diamino 5 formamidopyrimidine , and two product chemistry products , DNA adenine and water H sub 2 sub O . This enzyme belongs to the family of lyase s, specifically amidine lyases. The systematic name of this enzyme class is DNA 4,6 diamino 5 formamidopyrimidine C8 N9 lyase cyclizing DNA adenine forming . Other names in common use include DNA 4,6 diamino 5 formamidopyrimidine 8 C,9 N lyase cyclizing , DNA 4,6 diamino 5 formamidopyrimidine 8 C,9 N lyase cyclizing , and DNA adenine forming . References reflist 1 cite journal author Chetsanga CJ, Grigorian C date 1985 title In situ enzymatic reclosure of opened imidazole rings of purines in DNA damaged by gamma irradiation journal Proc. Natl. Acad. Sci. U.S.A. volume 82 pages 633&ndash 7 pmid 3856219 doi 10.1073 pnas.82.3.633 issue 3 pmc 397099 enzyme stub Category EC 4.3.2 Category Enzymes of unknown structure ... more details
enzyme Name discadenine synthase EC number 2.5.1.24 CAS number 74082 52 3 IUBMB EC number 2 5 1 24 GO code 0047870 image width caption In enzymology , a discadenine synthase EC number 2.5.1.24 is an enzyme that catalysis catalyzes the chemical reaction S adenosyl L methionine N sub 6 sub Delta sub 2 sub isopentenyl adenine math rightleftharpoons math 5 methylthioadenosine discadenine Thus, the two substrate biochemistry substrates of this enzyme are S adenosyl L methionine and N6 Delta2 isopentenyl adenine , whereas its two product chemistry products are 5 methylthioadenosine and discadenine . This enzyme belongs to the family of transferase s, specifically those transferring aryl or alkyl groups other than methyl groups. The systematic name of this enzyme class is S adenosyl L methionine N6 Delta2 isopentenyl adenine 3 3 amino 3 carboxypropyl transferase . Other names in common use include discadenine synthetase , S adenosyl L methionine 6 N Delta2 isopentenyl adenine , and 3 3 amino 3 carboxypropyl transferase . References reflist 1 cite journal author Taya Y, Tanaka Y, Nishimura S date 1978 title Cell free biosynthesis of discadenine, a spore germination inhibitor of Dictyostelium discoideum journal FEBS. Lett. volume 89 pages 326&ndash 8 pmid 566219 doi 10.1016 0014 5793 78 80247 6 issue 2 transferase stub Category EC 2.5.1 Category Enzymes of unknown structure ... more details
enzyme Name L glycol dehydrogenase EC number 1.1.1.185 CAS number 77967 75 0 IUBMB EC number 1 1 1 185 GO code 0050026 image width caption In enzymology , a L glycol dehydrogenase EC number 1.1.1.185 is an enzyme that catalysis catalyzes the chemical reaction an L glycol NAD P math rightleftharpoons math a 2 hydroxycarbonyl compound NAD P H H sup sup The 3 substrate biochemistry substrates of this enzyme are L glycol , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 4 product chemistry products are 2 hydroxycarbonyl compound , nicotinamide adenine dinucleotide NADH , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup . This enzyme belongs to the family of oxidoreductase s, specifically those acting on the CH OH group of donor with NAD or NADP as acceptor. The systematic name of this enzyme class is L glycol NAD P oxidoreductase . Other names in common use include glycol nicotinamide adenine dinucleotide phosphate , dehydrogenase , L glycol NAD P oxidoreductase , and L glycol NAD P dehydrogenase . References reflist 1 cite journal author Bernardo A, Burgos J, Martin R date 1981 title Purification and some properties of L glycol dehydrogenase from hen s muscle journal Biochim. Biophys. Acta. volume 659 pages 189&ndash 98 pmid 7018582 issue 1 1.1.1 enzyme stub Category EC 1.1.1 Category NADPH dependent enzymes Category NADH dependent enzymes Category Enzymes of unknown structure it L glicolo deidrogenasi ja L ... more details
enzyme Name sorbose 5 dehydrogenase NADP EC number 1.1.1.123 CAS number 37250 52 5 IUBMB EC number 1 1 1 123 GO code 0050287 image width caption In enzymology , a sorbose 5 dehydrogenase NADP EC number 1.1.1.123 is an enzyme that catalysis catalyzes the chemical reaction L sorbose NADP sup sup math rightleftharpoons math 5 dehydro D fructose NADPH H sup sup Thus, the two substrate biochemistry substrates of this enzyme are L sorbose and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 3 product chemistry products are 5 dehydro D fructose , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup . This enzyme belongs to the family of oxidoreductase s, specifically those acting on the CH OH group of donor with NAD or NADP as acceptor. The systematic name of this enzyme class is L sorbose NADP 5 oxidoreductase . Other names in common use include 5 ketofructose reductase , 5 keto D fructose reductase , sorbose nicotinamide adenine dinucleotide phosphate dehydrogenase , reduced nicotinamide adenine dinucleotide phosphate linked , reductase , and sorbose 5 dehydrogenase NADP . References reflist 1 cite journal author Englard S, Kaysen G, Avigad G date 1970 title 5 keto D fructose. VI. A specific reduced nicotinamide adenine dinucleotide phosphate linked reductase from yeast journal J. Biol. Chem. volume 245 pages 1311 8 pmid 4392628 issue 6 1.1.1 enzyme stub Category EC 1.1.1 Category NADPH dependent enzymes Category Enzymes of unknown structure it Sorbosio 5 deidrogenasi NADP ja 5 NADP ... more details
enzyme Name 3 imidazol 5 yl lactate dehydrogenase EC number 1.1.1.111 CAS number 37250 42 3 IUBMB EC number 1 1 1 111 GO code 0019155 image width caption In enzymology , a 3 imidazol 5 yl lactate dehydrogenase EC number 1.1.1.111 is an enzyme that catalysis catalyzes the chemical reaction S 3 imidazol 5 yl lactate NAD P math rightleftharpoons math 3 imidazol 5 yl pyruvate NAD P H H sup sup The 3 substrate biochemistry substrates of this enzyme are S 3 imidazol 5 yl lactate , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 4 product chemistry products are 3 imidazol 5 yl pyruvate , nicotinamide adenine dinucleotide NADH , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup . This enzyme belongs to the family of oxidoreductase s, specifically those acting on the CH OH group of donor with NAD or NADP as acceptor. The systematic name of this enzyme class is S 3 imidazol 5 yl lactate NAD P oxidoreductase . This enzyme is also called imidazol 5 yl lactate dehydrogenase . References reflist 1 cite journal author Coote JG, Hassall H date 1969 title The role of imidazol 5 yl lactate nicotinamide adenine dinucleotide phosphate oxidoreductase and histidine 2 oxoglutarate aminotransferase in the degradation of imidazol 5 yl lactate by Pseudomonas acidovorans journal Biochem. J. volume 111 pages 237&ndash 9 pmid 4303364 issue 2 pmc 1187811 cite journal author Cortese R, Brevet J, Hedegaard J, Roche J date 1968 title Identification and purification of an alpha ketoacid aromatic reductase of Escherichia coli B journal C. R. Seances. Soc. Biol. Fil. volume 162 pages 390&ndash 5 pmid 4237631 issue 2 1.1.1 enzyme stub Category EC 1.1.1 Category NADPH dependent enzymes Category NADH dependent enzymes Category Enzymes of unknown structure it 3 imidazolo 5 il lattato deidrogenasi ja 3 5 ... more details
chembox Name Coniferyl aldehyde ImageFile Coniferyl aldehyde.png ImageSize 200px ImageName Chemical structure of trans coniferyl aldehyde ImageAlt Chemical structure of trans coniferyl aldehyde IUPACName Z 3 4 hydroxy 3 methoxyphenyl prop 2 enal br E 3 4 hydroxy 3 methoxyphenyl prop 2 enal OtherNames Coniferaldehyde br cis coniferyl aldehyde br trans coniferyl aldehyde Section1 Chembox Identifiers CASNo 458 36 6 CASNo Ref CASOther PubChem 5352904 PubChem 5280536 ChEMBL 242529 ChemSpiderID 4444167 SMILES COC1 C C CC C1 C CC O O InChI InChI 1S C10H10O3 c1 13 10 7 8 3 2 6 11 4 5 9 10 12 h2 7,12H,1H3 b3 2 MeSHName Section2 Chembox Properties Formula C sub 10 sub H sub 10 sub O sub 3 sub MolarMass 178.18 g mol ExactMass 178.062994 u Appearance Density MeltingPt C BoilingPt C Solubility Coniferyl aldehyde is a low molecular weight phenolic compound susceptible to be extracted from Cork material cork stopper s into wine ref Polyphenolic Composition of Quercus suber Cork from Different Spanish Provenances. Elvira Conde, Estrella Cadah a, Mar a Concepci n Garc a Vallejo and Br gida Fern ndez de Sim n, J. Agric. Food Chem., 1998, 46 8 , pp 3166 3171 DOI 10.1021 jf970863k ref . Metabolism Coniferyl alcohol dehydrogenase uses coniferyl alcohol and nicotinamide adenine dinucleotide phosphate NADP sup sup to produce coniferyl aldehyde, nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup . Coniferyl aldehyde dehydrogenase uses coniferyl aldehyde, water H sub 2 sub O , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup to produce ferulate , nicotinamide adenine dinucleotide NADH , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup . Dihydroflavonol 4 reductase uses sinapaldehyde or coniferyl aldehyde or coumaraldehyde and Nicotinamide adenine dinucleotide phosphate NADPH to produce sinapyl alcohol or coniferyl alcohol or coumaryl alcohol respectively and NADP sup sup . S ... more details
Encyclopedia
top
