Pfam box Symbol PDEase I Name 3 5 cyclic nucleotide phosphodiesterase image width caption Pfam PF00233 InterPro IPR002073 SMART Prosite PDOC00116 SCOP 1f0j TCDB OPM family OPM protein enzyme Name 3 ,5 cyclic nucleotide phosphodiesterase EC number 3.1.4.17 CAS number 9040 59 9 IUBMB EC number 3 1 4 17 GO code 0051342 image width caption 3 5 cyclic nucleotide phosphodiesterases are a protein family family of phosphodiesterase phosphodiesterases . Generally, these enzymes hydrolyze some nucleoside 3 ,5 cyclic phosphate to some nucleoside 5 phosphate. Some examples of nucleoside 3 ,5 cyclic phosphate include 3 ,5 cyclic AMP 3 ,5 cyclic dAMP 3 ,5 cyclic IMP 3 ,5 cyclic GMP 3 ,5 cyclic CMP Function Phototransduction Retinal 3 ,5 cGMP phosphodiesterase EC number 3.1.4.17 PDE is located in photoreceptor outer segments and is an important enzyme in phototransduction. ref name isbn0 12 738440 5 cite book author Arkinstall S, Watson SP title The G protein linked receptor factsbook publisher Academic Press location Boston year 1994 pages 214 222 isbn 0 12 738440 5 chapter Opsins doi accessdate ref PDE in rod cells are oligomeric, made up of two heavy catalytic subunits, 90 kDa and 85 kDa, and two lighter inhibitory subunits 11 kDa each . ref name pmid2833739 cite journal author Deterre P, Bigay J, Forquet F, Robert M, Chabre M title cGMP phosphodiesterase of retinal rods is regulated by two inhibitory subunits journal Proc. Natl. Acad. Sci. U.S.A. volume 85 issue 8 pages 2424 8 year 1988 month April pmid 2833739 pmc 280009 doi ref PDE in rod cells are activated by transducin . Transducin is a G protein which upon GDP GTP exchange in the transducin subunit catalyzed by photolyzed rhodopsin. The transducin subunit T is released from the and complex and diffuses into the cytoplasmic solution to interact and activate PDE. Activation by T There are two proposed mechanisms for the activation of PDE. The first proposes that the two inhibitory subunits are differentially ... more details
unreferenced date November 2008 The International Nucleotide Sequence Database Collaboration INSDC, http insdc.org consists of a joint effort to collect and disseminate database s containing DNA and RNA sequences. It involves the following computerized database s DNA Data Bank of Japan Japan , GenBank USA and the EMBL European Molecular Biology Laboratory , Germany . New and updated data on nucleotide sequences contributed by research teams to each of the three databases are synchronized on a daily basis through continuous interaction between the staff at each the collaborating organizations. The DDBJ EMBL GenBank synchronization is maintained according to a number of guidelines which are produced and published by an International Advisory Board http insdc.org page.php?page advisors . The guidelines consist of a common definition of the feature tables http www.ebi.ac.uk embl Documentation FT definitions feature table.html for the databases, which regulate the content and syntax http www.ebi.ac.uk embl Documentation DTD INSDSeq v1.3.dtd.txt of the database entries, in the form of a common Document Type Definition DTD or Document Type Definition . The syntax is called INSDSeq and its core consists of the letter sequence of the gene expression amino acid sequence and the letter sequence for nucleotide bases in the gene or decoded segment. In http www.ebi.ac.uk cgi bin dbfetch?X56734 a DBFetch operation shows a typical INSD entry at the EBI database the same entry at NCBI is here http www.ncbi.nlm.nih.gov entrez viewer.fcgi?db nucleotide&val 21954 . See also National Center for Biotechnology Information Biological database Sequence database Bioinformatics DNA Data Bank of Japan External links http insdc.org INSDC main site http www.ebi.ac.uk embl Contact collaboration.html EMBL INSDC site http www.ebi.ac.uk embl index.html EMBL Nucleotide Database http www.ddbj.nig.ac.jp DNA Data Bank of Japan http www.ncbi.nlm.nih.gov entrez query.fcgi?db Nucleotide GenBank Nucleotide Search ... more details
orphan date October 2011 Infobox protein family Symbol EF1 GNE Name EF1 GNE image PDB 2b7c EBI.jpg width caption yeast guanine nucleotide exchange factor eef1balpha k205a mutant in complex with eef1a Pfam PF00736 Pfam clan InterPro IPR014038 SMART PROSITE PDOC00648 MEROPS SCOP 1b64 TCDB OPM family OPM protein CAZy CDD In molecular biology, the EF1 guanine nucleotide exchange domain is a protein domain found in the beta and delta chains of elongation factors from eukaryote eukaryotes and archaea . EEF1B2 Elongation factor EF1B also known as EF Ts or EF 1beta gamma delta is a nucleotide exchange factor that is required to regenerate eEF 1 EF1A from its inactive form EF1A GDP to its active form EF1A GTP . EF1A is then ready to Protein protein interaction interact with a new aminoacyl tRNA to begin the cycle again. EF1B is more complex in eukaryotes than in bacteria, and can consist of three subunits EF1B alpha or EF 1beta , EF1B gamma or EF 1gamma and EF1B beta or EF 1delta . ref name pmid12762045 cite journal author Andersen GR, Nyborg J title Structural studies of eukaryotic elongation factors journal Cold Spring Harb. Symp. Quant. Biol. volume 66 issue pages 425 37 year 2001 pmid 12762045 doi url ref The EF1 guanine nucleotide exchange domain is found in the beta EF 1beta, also known as EF1B alpha and delta EF 1delta, also known as EF1B beta chains of EF1B protein s from eukaryote eukaryotes and archaea . The beta and delta chains have exchange activity, which mainly resides in their homologous guanine nucleotide exchange domains, found in the C terminal region of the peptide s. Their N terminal regions may be involved in interactions with the gamma chain EEF1G EF 1gamma . ref name pmid10368288 Cite pmid 10368288 ref References reflist InterPro content IPR014038 Category Protein domains ... more details
enzyme Name 2 ,3 cyclic nucleotide 2 phosphodiesterase EC number 3.1.4.16 CAS number 9037 18 7 IUBMB EC number 3 1 4 16 GO code 0008663 image width caption In enzymology , a 2 ,3 cyclic nucleotide 2 phosphodiesterase EC number 3.1.4.16 is an enzyme that catalysis catalyzes the chemical reaction nucleoside 2 ,3 cyclic phosphate H sub 2 sub O math rightleftharpoons math nucleoside 3 phosphate Thus, the two substrate biochemistry substrates of this enzyme are nucleoside 2 ,3 cyclic phosphate and water H sub 2 sub O , whereas its product chemistry product is nucleoside 3 phosphate . This enzyme belongs to the family of hydrolase s, specifically those acting on phosphoric ester diester bonds. The systematic name of this enzyme class is nucleoside 2 ,3 cyclic phosphate 3 nucleotidohydrolase . Other names in common use include ribonucleoside 2 ,3 cyclic phosphate diesterase , 2 ,3 cyclic AMP phosphodiesterase , 2 ,3 cyclic nucleotidase , cyclic 2 ,3 nucleotide 2 phosphodiesterase , cyclic 2 ,3 nucleotide phosphodiesterase , 2 ,3 cyclic nucleoside monophosphate phosphodiesterase , 2 ,3 cyclic AMP 2 phosphohydrolase , cyclic phosphodiesterase 3 nucleotidase , 2 ,3 cyclic nucleotide phosphohydrolase , 2 3 cyclic phosphodiesterase , and 2 3 cyclic nucleotide phosphodiesterase 3 nucleotidase . This enzyme participates in purine metabolism and pyrimidine metabolism . References reflist 1 cite journal author ANRAKU Y date 1964 title A NEW CYCLIC PHOSPHODIESTERASE HAVING A 3 NUCLEOTIDASE ACTIVITY FROM ESCHERICHIA COLI B. I. PURIFICATION AND SOME PROPERTIES OF THE ENZYME journal J. Biol. Chem. volume 239 pages 3412&ndash 9 pmid 14245396 cite journal author ANRAKU Y date 1964 title A NEW CYCLIC PHOSPHODIESTERASE HAVING A 3 NUCLEOTIDASE ACTIVITY FROM ESCHERICHIA COLI B. II. FURTHER STUDIES ON SUBSTRATE SPECIFICITY AND MODE OF ACTION OF THE ENZYME journal J. Biol. Chem. volume 239 pages ... Studies on 2 ,3 cyclic nucleotide 3 phosphohydrolase from brain journal Can. J. Biochem. volume ... more details
PBB geneid 1260 Cyclic nucleotide gated channel alpha 2 , also known as CNGA2 , is a human gene encoding an ion channel protein. ref name entrez cite web title Entrez Gene CNGA2 cyclic nucleotide gated channel alpha 2 url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ShowDetailView&TermToSearch 1260 accessdate ref The PBB Summary template is automatically maintained by Protein Box Bot. See Template PBB Controls to Stop updates. PBB Summary section title summary text See also Cyclic nucleotide gated ion channel References reflist Further reading refbegin 2 PBB Further reading citations cite journal author Trudeau MC, Zagotta WN title Calcium calmodulin modulation of olfactory and rod cyclic nucleotide gated ion channels. journal J. Biol. Chem. volume 278 issue 21 pages 18705 8 year 2003 pmid 12626507 doi 10.1074 jbc.R300001200 cite journal author Hofmann F, Biel M, Kaupp UB title International Union of Pharmacology. LI. Nomenclature and structure function relationships of cyclic nucleotide regulated channels. journal Pharmacol. Rev. volume 57 issue 4 pages 455 62 year 2006 pmid 16382102 doi 10.1124 pr.57.4.8 cite journal author Distler M, Biel M, Flockerzi V, Hofmann F title Expression of cyclic nucleotide gated cation channels in non sensory tissues and cells. journal Neuropharmacology volume 33 issue 11 pages 1275 82 year 1995 pmid 7532814 doi 10.1016 0028 3908 94 90027 2 cite journal author Finn JT, Krautwurst D, Schroeder JE, et al. title Functional co assembly among subunits of cyclic nucleotide activated, nonselective cation channels, and across species from nematode to human. journal Biophys. J. volume 74 issue 3 pages 1333 45 year 1998 pmid 9512030 doi 10.1016 S0006 3495 98 77846 4 pmc 1299480 cite journal author Sautter A, Zong X, Hofmann F, Biel M title An isoform of the rod photoreceptor cyclic nucleotide gated channel beta subunit expressed in olfactory ... nucleotide gated channel CNGA2 in vascular tissues. journal Histochem. Cell Biol. volume 120 issue 6 ... more details
Cyclic nucleotide gated ion channels or CNG channels are ion channel s that function in response to the binding of cyclic nucleotide s. CNG channels are nonselective cation channels that are found in the membranes ... of cyclic nucleotide gated ion channels in sea urchin sperm chemotaxis. Discovery The discovery of CNG ... other tissues. ref name king cite journal author Yau KW title Cyclic nucleotide gated channels an expanding ... Kaupp UB, Seifert R title Cyclic nucleotide gated ion channels journal Physiol. Rev. volume 82 ... Cloning and Functional Characterization of a New Modulator y Cyclic Nucleotide Gated Channel ... nucleotide binding domain CNBD and connection region to the S6 segment in the carboxy terminal. There is a post ... first1 Kimberly last2 Zagotta first2 William N. title Cyclic Nucleotide Gated Ion Channels journal ... annurev.cellbio.19.110701.154854 ref Alpha subunits Cyclic nucleotide gated channel alpha subunits include Cyclic nucleotide gated channel alpha 1 Cyclic nucleotide gated channel alpha 2 Cyclic nucleotide gated channel alpha 3 Cyclic nucleotide gated channel alpha 4 Beta subunits Cyclic nucleotide gated channel beta subunits include Cyclic nucleotide gated channel beta 1 Cyclic nucleotide gated .... ref name photoreceptors2 Cyclic nucleotide binding domain A Cyclic nucleotide binding domain ... nucleotide binding proteins. The domain is believed to be made up of a beta sheet pleated sheet ... helix is flexible in closed channels. When an helix of a Cyclic nucleotide gated channel alpha .... When a ligand binds to the pleated sheet, this bound cyclic nucleotide stabilizes the movement ... Mechanisms of Cyclic Nucleotide Gated Ion Channel Gating journal Journal of Genetics and Genomics ... 27, 2011 ref File PDB 1wgp EBI.jpg thumb Illustration of a cyclic nucleotide gated ion channel .... When the cyclic nucleotide gated ion channels are closed, the cytoplasmic ends of the S6 helices .... The P region dictates the ion selectivity of the cyclic nucleotide gated ion channel, which also ... more details
PBB geneid 1261 Cyclic nucleotide gated cation channel alpha 3 is a protein that in humans is encoded by the CNGA3 gene . ref name pmid7532814 cite journal author Distler M, Biel M, Flockerzi V, Hofmann F title Expression of cyclic nucleotide gated cation channels in non sensory tissues and cells journal Neuropharmacology volume 33 issue 11 pages 1275 82 year 1995 month Mar pmid 7532814 pmc doi 10.1016 0028 3908 94 90027 2 ref ref name pmid9517456 cite journal author Wissinger B, Muller F, Weyand I, Schuffenhauer S, Thanos S, Kaupp UB, Zrenner E title Cloning, chromosomal localization and functional expression of the gene encoding the alpha subunit of the cGMP gated channel in human cone photoreceptors journal Eur J Neurosci volume 9 issue 12 pages 2512 21 year 1998 month Apr pmid 9517456 pmc doi 10.1111 j.1460 9568.1997.tb01680.x ref ref name pmid16382102 cite journal author Hofmann F, Biel M, Kaupp UB title International Union of Pharmacology. LI. Nomenclature and structure function relationships of cyclic nucleotide regulated channels journal Pharmacol Rev volume 57 issue 4 pages 455 62 year 2005 month Dec pmid 16382102 pmc doi 10.1124 pr.57.4.8 ref ref name entrez cite web title Entrez Gene CNGA3 cyclic nucleotide gated channel alpha 3 url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ShowDetailView&TermToSearch 1261 accessdate ref The PBB Summary template is automatically ... summary text This gene encodes a member of the cyclic nucleotide gated cation channel protein family ... Gene CNGA3 cyclic nucleotide gated channel alpha 3 url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ... 129 issue 9 pages 1212 7 pmid 21911670 ref and color blindness. See also Cyclic nucleotide gated ion ... RS, Yau KW title The heteromeric cyclic nucleotide gated channel adopts a 3A 1B stoichiometry ... Subunit configuration of heteromeric cone cyclic nucleotide gated channels. journal Neuron volume ... in the human cone photoreceptor cyclic nucleotide gated channel CNGA3 subunit. journal Am. J. Physiol ... more details
PBB geneid 54714 Cyclic nucleotide gated channel beta 3 , also known as CNGB3 , is a human gene encoding an ion channel protein. ref name entrez cite web title Entrez Gene CNGB3 cyclic nucleotide gated channel beta 3 url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ShowDetailView&TermToSearch 54714 accessdate ref The PBB Summary template is automatically maintained by Protein Box Bot. See Template PBB Controls to Stop updates. PBB Summary section title summary text See also Cyclic nucleotide gated ion channel Stargardt disease References reflist Further reading refbegin 2 PBB Further reading citations cite journal author Hofmann F, Biel M, Kaupp UB title International Union of Pharmacology. LI. Nomenclature and structure function relationships of cyclic nucleotide regulated channels. journal Pharmacol. Rev. volume 57 issue 4 pages 455 62 year 2006 pmid 16382102 doi 10.1124 pr.57.4.8 cite journal author Koenekoop RK, Lopez I, den Hollander AI, et al. title Genetic testing for retinal dystrophies and dysfunctions benefits, dilemmas and solutions. journal Clin. Experiment. Ophthalmol. volume 35 issue 5 pages 473 85 year 2007 pmid 17651254 doi 10.1111 j.1442 9071.2007.01534.x cite journal author Pentao L, Lewis RA, Ledbetter DH, et al. title Maternal uniparental isodisomy of chromosome 14 association with autosomal recessive rod monochromacy. journal Am. J. Hum. Genet. volume 50 issue 4 pages 690 9 year 1992 pmid 1347967 doi pmc 1682625 cite journal author Winick JD, Blundell ... terminal regions of the cone photoreceptor cyclic nucleotide gated channel CNGB3 subunit. journal ... cone photoreceptor cyclic nucleotide gated channel CNGB3 subunit alters the ligand sensitivity and pore ... cyclic nucleotide gated channels. journal Neuron volume 42 issue 3 pages 401 10 year 2004 pmid 15134637 ... produce gain of function alterations in cone cyclic nucleotide gated channels. journal Mol. Vis. volume ... MD title Regulation of human cone cyclic nucleotide gated channels by endogenous phospholipids and exogenously ... more details
PBB geneid 1262 Cyclic nucleotide gated cation channel alpha 4 is a protein that in humans is encoded by the CNGA4 gene . ref name pmid11764791 cite journal author Bradley J, Frings S, Yau KW, Reed R title Nomenclature for Ion channel Subunits journal Science volume 294 issue 5549 pages 2095 6 year 2001 month Dec pmid 11764791 pmc 2901924 doi 10.1126 science.294.5549.2095 ref ref name pmid16382102 cite journal author Hofmann F, Biel M, Kaupp UB title International Union of Pharmacology. LI. Nomenclature and structure function relationships of cyclic nucleotide regulated channels journal Pharmacol Rev volume 57 issue 4 pages 455 62 year 2005 month Dec pmid 16382102 pmc doi 10.1124 pr.57.4.8 ref ref name entrez cite web title Entrez Gene CNGA4 cyclic nucleotide gated channel alpha 4 url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ShowDetailView&TermToSearch 1262 accessdate ref The PBB Summary template is automatically maintained by Protein Box Bot. See Template PBB Controls to Stop updates. PBB Summary section title summary text CNGA4 is a modulatory subunit of vertebrate cyclic nucleotide gated membrane channels that transduce odorant signals Munger et al., 2001 . supplied by OMIM ref name entrez See also Cyclic nucleotide gated ion channel References reflist Further reading refbegin 2 PBB Further reading citations cite journal author Ota T title Complete sequencing and characterization of 21,243 full length human cDNAs journal Nat. Genet. volume 36 issue 1 pages 40 5 year 2004 pmid 14702039 doi 10.1038 ng1285 author separator , author2 Suzuki Y author3 Nishikawa T display authors 3 last4 Otsuki first4 Tetsuji last5 Sugiyama first5 Tomoyasu last6 Irie first6 Ryotaro last7 Wakamatsu first7 Ai last8 Hayashi first8 Koji last9 Sato first9 Hiroyuki cite journal author Kelliher KR title Importance of the CNGA4 channel gene for odor discrimination and adaptation in behaving ... M title An isoform of the rod photoreceptor cyclic nucleotide gated channel subunit expressed in olfactory ... more details
PBB geneid 1259 Cyclic nucleotide gated channel alpha 1 , also known as CNGA1 , is a human gene encoding an ion channel protein. ref name entrez cite web title Entrez Gene CNGA1 cyclic nucleotide gated channel alpha 1 url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ShowDetailView&TermToSearch 1259 accessdate ref The PBB Summary template is automatically maintained by Protein Box Bot. See Template PBB Controls to Stop updates. PBB Summary section title summary text See also Cyclic nucleotide gated ion channel References reflist Further reading refbegin 2 PBB Further reading citations cite journal author Hofmann F, Biel M, Kaupp UB title International Union of Pharmacology. LI. Nomenclature and structure function relationships of cyclic nucleotide regulated channels. journal Pharmacol. Rev. volume 57 issue 4 pages 455 62 year 2006 pmid 16382102 doi 10.1124 pr.57.4.8 cite journal author Pittler SJ, Lee AK, Altherr MR, et al. title Primary structure and chromosomal localization of human and mouse rod photoreceptor cGMP gated cation channel. journal J. Biol. Chem. volume 267 issue 9 pages 6257 62 year 1992 pmid 1372902 doi cite journal author Arsenault TV, Sauder DN, Harley CB, McKenzie RC title Identification and characterization of a partial cDNA expressing interleukin 1 like activity in keratinocytes. journal Mol. Immunol. volume 29 issue 3 pages 431 8 year 1992 pmid 1372959 doi 10.1016 0161 5890 92 90031 R cite journal author Dhallan RS, Macke JP, Eddy RL, et al. title Human rod photoreceptor cGMP gated channel amino acid sequence, gene structure, and functional expression ... cite journal author Distler M, Biel M, Flockerzi V, Hofmann F title Expression of cyclic nucleotide ..., Molday LL, Molday RS, Yau KW title The heteromeric cyclic nucleotide gated channel adopts a 3A 1B ... doi 10.1038 nature01201 cite journal author Zheng J, Trudeau MC, Zagotta WN title Rod cyclic nucleotide ..., cGMP dependent protein kinase I alpha and beta, and cyclic nucleotide gated channel subunit 1 in the rat ... more details
class wikitable Mutation number Nucleotide change Position base pair Total size base pair s Position Forward 5 3 Reverse 5 3 M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc M3 M4 M8 M9 M15 M17 M20 M33 M35 M38 M40 M42 M45 M52 M55 M57 M60 M64.1 M75 M89 M91 M94 M95 M96 M105 M122 M124 M130 M131 M132 M139 M145 M168 M170 M172 M173 M174 M175 M176 M179 M201 M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg M241 Guanine G to Adenine A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M242 Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt M258 M267 Thymine T to Guanine G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M268 M269 M285 Guanine G to Cytosine C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M286 Guanine G to Adenine A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M287 Adenine A to Thymine T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M297 M299 M304 Adenine A to Cytosine C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt M306 M335 Thymine T to Adenine A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta M339 Thymine T to Guanine G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt M340 Guanine G to Cytosine C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa M342 Cytosine C to Thymine T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact M343 Cytosine C to Adenine A 402 424 tttaacctcctccagctctgca acccccacatatctccagg M347 M349 Guanine G to Thymine T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct M356 M359 Thymine T to Cytosine C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt M365 Adenine A to Guanine G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M367 Adenine A to Guanine G 196 274 ccttcatttaggctgtagctgc ... to Guanine G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M405 See also Single nucleotide polymorphism ... more details
Pfam box Symbol FAD binding 1 Name FAD binding domain image width caption Pfam PF00667 InterPro IPR003097 SMART Prosite SCOP 1amo TCDB OPM family OPM protein PDB PDB3 1ddi A 229 424 PDB3 1ddg A 229 424 PDB3 1f20 A 985 1214 PDB3 1tll B 985 1214 PDB3 1ja1 A 274 493 PDB3 1ja0 A 274 493 PDB3 1j9z A 274 493 PDB3 1amo A 274 493 PDB3 2bf4 B 261 481 PDB3 2bn4 A 261 481 Flavoprotein pyridine nucleotide cytochrome reductases ref name PUB00002674 cite journal author Hyde GE, Crawford NM, Campbell WH title The sequence of squash NADH nitrate reductase and its relationship to the sequences of other flavoprotein oxidoreductases. A family of flavoprotein pyridine nucleotide cytochrome reductases journal J. Biol. Chem. volume 266 issue 35 pages 23542 23547 year 1991 pmid 1748631 ref catalyse the interchange of reducing equivalents between one electron carriers and the two electron carrying FAD nicotinamide dinucleotide s. The enzymes include ferredoxin NADP reductase s ref name PUB00002370 cite journal author Karplus PA, Bruns CM title Structure function relations for ferredoxin reductase journal J. Bioenerg. Biomembr. volume 26 issue 1 pages 89 99 year 1994 pmid 8027025 doi 10.1007 BF00763221 ref , plant and fungal NAD P H nitrate reductases ref name PUB00002674 ref name PUB00010574 cite journal author Siverio JM title Assimilation of nitrate by yeasts journal FEMS Microbiol. Rev. volume 26 issue 3 pages 277 284 year 2002 pmid 12165428 doi 10.1111 j.1574 6976.2002.tb00615.x ref , cytochrome b5 reductase s ref name PUB00002328 cite journal author Iwanaga S, Miyata T, Yubisui T, Tamura M, Takeshita M title Complete amino acid sequence of NADH cytochrome b5 reductase purified from human erythrocytes journal J. Biochem. volume 99 issue 2 pages 407 422 year 1986 pmid 3700359 ref , cytochrome P450 reductase s ref name PUB00005367 cite journal author Porter TD title An unusual yet strongly conserved flavoprotein reductase in bacteria and mammals journal Trends Biochem. Sci. volume 16 iss ... more details
Discovery and development of nucleoside and nucleotide reverse transcriptase inhibitors NRTIs and NtRTIs began in the 1980s when the AIDS epidemic hit Western societies. NRTIs inhibit the reverse transcriptase RT , an enzyme that controls the replication of the genetic material of the human immunodeficiency virus HIV . The first NRTI was zidovudine , approved by the U.S. Food and Drug Administration ... followed. The NRTIs and the NtRTI are analogues of endogenous 2 deoxy nucleoside and nucleotide. Drug ... ref Antiretroviral drugs for the treatment of HIV infections belong to six categories Nucleoside and nucleotide ... last1 Cihlar first1 T. last2 Ray first2 A.S. title Nucleoside and nucleotide HIV reverse transcriptase ... in 1987, six nucleosides and one nucleotide reverse transcriptase inhibitor NRTI have been approved ... , lamivudine , abacavir and emtricitabine and the only nucleotide reverse transcriptase inhibitor .... B Mechanism of action of the nucleotide analogue reverse transcriptase inhibitor, tenofovir ... doi 10.1096 fj.07 8697rev pmid 17639073 ref Mechanism of action Activation of nucleoside and nucleotide ... and therefore this step is very important. NRTIs are analogues of endogenous 2 deoxy nucleoside and nucleotide ... of nucleoside and nucleotide Reverse transcriptase inhibitor induced mitochondrial toxicity journal ... which provides the attachment point for the next nucleotide in the growing DNA chain during the reverse ... 200px Acyclic nucleotide the only approved NtRTI Nucleotide analogues require only two phosphorlylation ... have led to the development of phosphonate nucleotide analogues such as tenofovir ... last2 Piacenti first1 F.J. last3 Stone first1 E.A. title Tenofovir Disoproxil Fumarate A Nucleotide ... nucleotide reverse transcriptase inhibitor approved by the FDA for the treatment of HIV 1 infection ... efefef style background efefef border right 2px solid black Nucleotide analogue colspan 7 style ... medicines Category Drug discovery Nucleoside And Nucleotide Reverse transcriptase Inhibitors, Discovery ... more details
orphan date February 2010 N nucleotides , or nontemplated nucleotides are believed to exist only to create diversity at V D J junctions see V D J recombination during lymphocyte development ref name NCBI http www.ncbi.nlm.nih.gov pmc articles PMC390357 http www.ncbi.nlm.nih.gov pmc articles PMC390357 ref . The addition of these nucleotides is aided by an enzyme called Terminal deoxynucleotidyl transferase TdT References reflist Category Nucleotides ... more details
A nuclear run on assay is conducted to identify the gene s that are being transcription genetics transcribed at a certain time. Cell nucleus Cell nuclei are isolated rapidly, and incubated with labelled nucleotide s and the results are hybridized to a slot blot , which is then exposed to film. It was originally developed by Gariglio et al. 1981 and Brown et al. 1984 see discussion . Adding actinomycin D to the reaction buffer is sufficient to stop transcription, while other toxins, such as amanitin, show different effects, making it a good way to assay the effects of these compounds. This method allows changes in Transcription genetics transcription rates to be measured, which often differ from steady state mRNA levels used in microarrays. Although the method is time consuming and requires the use of radioactivity and large numbers of cells, it remains the most reliable method to measure transcription rates directly. Several attempts recently have been made to make this method microarray compatible, but other methods are much more favorable. To have a publication quality blot about 10 sup 7 sup nuclei are needed, but 10 sup 6 sup nuclei are sufficient to give results these quantities of cells are higher than for most protocols. It is often cited that this method has been surpassed by microarrays, even though this method compares transcription rates and not total transcript expression levels, which differ. It is incompatible with microarray experiments due to the fact eukaryotic polymerases are more intolerant towards fluorescently labeled or aminoallyl nucleotides, so UTP with phosphorus 32, or phosphorus 33, on the alpha phosphate group is normally used. Cheadle et al. 2005 used spotted nylon blots to obtain a high throughput analysis of T cell activation. Garcia Martinez et al 2004 developed a protocol for the yeast S. cerevisiae Genomic run on, GRO that allows for the calculation of transcription rates TRs for all yeast genes. Those authors also used the calcul ... more details
as fluorescent probes, either directly or indirectly, such as aminoallylnucleotide , which are used .... Citation needed date April 2012 See also Nucleoside Nucleotide DNA RNA Nucleic acid notation ... more details
is typically copied using a nucleotide with an arm and later coupled with a reactive fluorophore indirect labelling amine reactive Aminoallylnucleotide contain a primary amine group on a linker ... structure of dyT br Size widened dyT br File Aminoallyl Uridine.gif 70px Chemical structure of Aminoallyl Uridine br Aminoallylnucleotide br File 2 amino 6 2 thienyl purine S .gif 70px Chemical structure ... membranes. Molecular biology File Nucleoside analogues.svg thumb 200px right Common changes in nucleotide ... ring Fluorophores main Fluorophore File Aminoallyl Uridine.svg thumb 200px Structure of aminoallyl .... ref and many other ones see recent reviews . ref Rist et al. Fluorescent nucleotide base analogs as probes ... biology Oligonucleotide synthesis Expanded genetic code Nucleobase , nucleoside , nucleotide , and nucleic ... more details
The AP 1 binding site , also known as the AP 1 promoter site, is a DNA nucleotide sequence to which AP 1 Activator Protein 1 is able to bind. The AP 1 binding site, in humans, has a nucleotide sequence of TGAGTCA. External links http www.cbil.upenn.edu MTIR vim sites.html MARKER vim seq AP 1 Nucleotide Sequence Category DNA molecular cell biology stub ... more details
nucleic acids lack, nucleotide s have to be modified with aminoallyl groups. This is done through incorporating aminoallyl modified nucleotides during synthesis reactions. A good ratio is a label ... more details
unreferenced date March 2010 mt SNP is a single nucleotide polymorphism on the Mitochondrial DNA mitochondrial chromosome . mt SNPs are often used in maternal genealogical DNA test ing. SNP markers A single nucleotide polymorphism SNP is a change to a single nucleotide in a DNA sequence . The relative mutation rate for an SNP is extremely low. This makes them ideal for marking the history of the human genetic tree. SNPs are named with a letter code and a number. The letter indicates the lab or research team that discovered the SNP. The number indicates the order in which it was discovered. For example M173 is the 173rd SNP, documented by the Human Population Genetics Laboratory at Stanford University , which uses the letter M. See also Y SNP Single nucleotide polymorphism Short tandem repeat Haplogroup Haplotype Genealogical DNA test Category Single nucleotide polymorphisms ... more details
Unreferenced stub auto yes date December 2009 Context date October 2009 Sequential walking is a technique that can be used to solve various 2D Nuclear magnetic resonance NMR spectra. In a 2D experiment, cross peaks must be correlated to the correct nuclei. Using sequential walking, the correct nuclei can be assigned to their crosspeaks. The assigned crosspeaks can give valuable information such as spatial interactions between nuclei. In a NOESY of DNA , for example, each nucleotide has a different chemical shift associated with it. In general, A s are more downstream, T s are more upstream, and C s and G s are intermediate. Each nucleotide has protons on the deoxyribose sugar, which can be assigned using sequential walking. To do this, the first nucleotide in the sequence must be detected. Knowing the DNA sequence helps, but in general the first nucleotide can be determined using the following rules. 1. 2 and 2 protons of a nucleotide will show up in its column, as well as in the column of the next nucleotide in the sequence. For example, in the sequence CATG, in the column for C, its own 2 and 2 protons will be seen, but none of the other nucleotides. For A, its own 2 and 2 protons will be seen, as well as those from C. 2. Methyl groups on the nucleotide are seen in the column for the nucleotide containing a methyl group, as well as for the nucleotide preceding it. For example, in CATG, the A and T will contain the methyl peak corresponding to the methyl group on T, but G will not. Once the first nucleotide has been found, you determine which nucleotide is next to it because it should contain the 2 and 2 protons form the previous nucleotide. This is done by walking across the spectrum. This process is then repeated sequentially until all nucleotides have been assigned. DEFAULTSORT Sequential Walking Category Nuclear magnetic resonance Chemistry stub ... more details
A region of DNA that is adjacent to the 5 end of the gene. The 5 flanking region contains the promoter, and may contain enhancers or other protein binding sites. It is the region of DNA that is not transcribed into RNA. Flanking SNPs are Single nucleotide polymorphism Single nucleotide polymorphisms SNP that appear in the flanking region. Category DNA genetics stub ... more details
Unreferenced stub auto yes date December 2009 Orphan date December 2009 An NTP binding site is a type of binding site found in nucleoside monophosphate NMP kinase s, N can be adenosine or guanosine . A P loop is one of the structural motif s common for nucleoside triphosphate NTP binding sites, it interacts with the bound nucleotide s phosphoryl groups. For the binding site to be able to bind a nucleotide, the nucleotide must be complex bound to Mg sup 2 sup or Mn sup 2 sup . Nucleotide binding will cause conformational changes in the protein because the P loop will bend. DEFAULTSORT Ntp Binding Site Category Enzymes Category Nucleosides Category Nucleotides Biochem stub ... more details
CDC25 can refer to Cdc25 , a cell division cycle protein Another name for ras GRF1 , a guanine nucleotide exchange factor Letter NumberCombDisambig Long comment to avoid listing on Special Shortpages............................................................................... more details