Search: in
Endonuclease
Endonuclease in Encyclopedia Encyclopedia
  Tutorials     Encyclopedia     Videos     Books     Software     DVDs  
       
Encyclopedia results for Endonuclease

Endonuclease





Encyclopedia results for Endonuclease

  1. Endonuclease

    vwxyz , where vwx names the life form bacteria where this restriction endonuclease may be found ... in the same life form bacteria . Thus for example, EcoRI means that the restriction endonuclease is found in Escherichia coli Eco strain RY13 R , restriction endonuclease number I . Another .... ref ibid., pp. 63, 64 ref Restriction endonucleases come in several types. A restriction endonuclease ... endonuclease is referred to as Type I. If the recognition sequence overlaps with the cleavage sequence, then the restriction endonuclease restriction enzyme is Type II. Restriction endonucleases ... endonuclease, see ref ibid., p. 64. ref Common endonucleases Restriction endonucleases ENases ... endonuclease is a well documented endonuclease found in E.coli . See also Exonuclease Nuclease ... Endonuklease fa fr Endonucl ase it Endonucleasi nl Endonuclease pl Endonukleazy ru ...   more details



  1. Homing endonuclease

    they facilitate the perpetuation of the genetic elements that encode them. Homing endonuclease recognition ... found in only one instance per genome . Generally, the gene encoding the endonuclease the HEG, homing endonuclease gene is located within the recognition sequence which the enzyme cuts, thus ..., HEG sup sup , that contains the gene for the endonuclease. Thus, the gene is copied to the allele ... cite journal author Burt A, Koufopanou V title Homing endonuclease genes the rise and fall and rise ... BL title Design, activity, and structure of a highly specific artificial endonuclease journal ... litoralis , and H DreI , ref name pmid12419232 the first synthetic homing endonuclease, created in a laboratory ..., Monnat RJ, Stoddard BL title DNA recognition and cleavage by the LAGLIDADG homing endonuclease I ... distortion by the PI SceI endonuclease, an enzyme generated by protein splicing journal J Mol Biol volume ... component of a DNA endonuclease involved in intron mobility journal Cell volume 83 issue 4 month ... 130 font size 86 Dimer of the I CreI homing endonuclease. ref name pmid9809068 Alpha helix Alpha ... element . Infobox protein family Symbol LAGLIDADG 1 Name LAGLIDADG endonuclease image PDB 1p8k EBI.jpg width caption the structure and dna recognition of a bifunctional homing endonuclease and group ... DNA endonuclease family image PDB 1r7m EBI.jpg width caption the homing endonuclease i scei bound ... cite journal author Heath, P. title The structure of I Crel, a group I intron encoded homing endonuclease ... of PI SceI, a homing endonuclease with protein splicing activity journal Cell volume 89 issue 4 ... The following year, the first structure of a homing endonuclease I CreI bound to its DNA target site ... by the LAGLIDADG homing endonuclease I CreI journal Molecular Cell volume 2 issue 4 month ... of the DNA binding domain of intron endonuclease I TevI with its substrate journal EMBO J. volume ... structure and hypothesis for function of GIY YIG intron endonuclease I TevI journal Nature Structural ...   more details



  1. UvrABC endonuclease

    UvrABC endonuclease is a multienzyme complex in Escherichia coli E.coli bacteria involved in DNA repair mechanism by nucleotide excision repair , and it is, therefore, sometimes called an excinuclease . This UvrABC repair process, sometimes called the short patch process, involves the removal of 12 nucleotides where a genetic mutation has occurred followed by a DNA polymerase, replacing these aberrant nucleotides with the correct nucleotides and completing the DNA repair . This enzyme complex is able to repair many different types of damage, including cyclobutyl dimer formation. Mechanism Two UvrA proteins form a dimer and they both have ATPase GTPase activity. The UvrA protein dimer dimer binds with UvrB and forms a protein trimer trimer that is able to detect DNA damage .The UvrA dimer functions as the unit responsible for the detection of DNA damage, probably through a mechanism of detecting distortions in the DNA double helix . The UvrB part of the trimer attaches to the double helix at the damaged site. The UvrA dimer leaves and a UvrC protein comes in and binds to the UvrB monomer and, hence, forms a new UvrBC dimer. This dimer is responsible for cleaving the nucleotides either side of the DNA damage. UvrB cleaves a phosphodiester bond 4 nucleotides downstream of the DNA damage, and the UvrC cleaves a phosphodiester bond 8 nucleotides upstream of the DNA damage and created 12 nucleotide excised segment. DNA helicase II sometimes called UvrD then comes in and removes the excised segment by removing the base pairing. The UvrB still remains in place even though UvrC has disassociated at this stage, as UvrB may be involved to prevent the reannealing of the excised DNA. DNA polymerase I comes in and fills in the correct nucleotides sequence, kicking off UvrB in the process, and the last phosphodiester bond is completed by DNA ligase. See also DNA repair endonuclease Nucleotide excision repair DNA External links MeshName uvrABC endonuclease Nucleases Enzyme stub Genetics ...   more details



  1. Flap endonuclease

    Flap endonucleases FENs, also known as 5 nucleases in older references are a class of nucleolytic enzymes that act as both Directionality molecular biology 5 3 exonucleases and structure specific endonucleases on specialised DNA structures that occur during the biological processes of DNA replication , DNA repair and DNA recombination. Flap endonucleases have been identified in eukaryotes , prokaryotes , archaea and some virus es. Organisms can have more than one FEN Homology biology homologue , this redundancy may give an indication of the importance of these enzymes. In prokaryotes, the FEN enzyme is found as an N terminus N terminal domain of DNA polymerase I, but some prokaryotes appear to encode a second homologue. ref cite journal doi 10.1006 jtbi.1994.1202 title Computer Aided Identification of a Potential 5 3 Exonuclease Gene Encoded by Escherichia coli year 1994 last1 Sayers first1 Jon R. journal Journal of Theoretical Biology volume 170 issue 4 pages 415 21 pmid 7996866 ref ref cite journal doi 10.1146 annurev.biochem.73.012803.092453 title FLAP ENDONUCLEASE 1 A Central Component of DNA Metabolism year 2004 last1 Liu first1 Yuan last2 Kao first2 Hui I last3 Bambara first3 Robert A. journal Annual Review of Biochemistry volume 73 pages 589 615 pmid 15189154 ref ref cite journal doi 10.1016 S0968 0004 98 01259 6 title Structure specific DNA cleavage by 5 nucleases year 1998 last1 Ceska first1 T journal Trends in Biochemical Sciences volume 23 issue 9 pages 331 6 pmid 9787638 last2 Sayers first2 JR ref The endonuclease activity of FENs was initially identified as acting on a DNA duplex which has a single stranded 5 overhang on one of the strands termed a 5 flap , hence the name flap endonuclease . ref cite journal pmid 8131753 year 1994 last1 Harrington first1 John J. last2 Lieber first2 Michael R. title The characterization of a mammalian DNA structure specific endonuclease volume 13 issue 5 pages 1235 46 pmc 394933 journal The EMBO journal ref FENs catalyse ...   more details



  1. AP endonuclease

    endonuclease from HeLa cells References Molecular graphics images were produced using the UCSF .... Chem. 25 volume 12 pages 1605 1612 year 2004 ref reflist DEFAULTSORT Ap Endonuclease Category Enzymes ...   more details



  1. Mung bean endonuclease

    Mung bean endonuclease is a single strand specific DNA and RNA endonuclease which will degrade single stranded extensions from the ends of DNA and RNA molecules, leaving blunt, ligatable ends. ref http www.neb.com nebecomm products productm0250.asp ref References reflist refbegin http www.neb.com nebecomm products productm0250.asp refend Category Enzymes enzyme stub ...   more details



  1. Polymerase-endonuclease amplification reaction

    File Journal pone 0008430 g001.png thumb Journal pone 0008430 g001 Polymerase endonuclease amplification reaction PEAR is a DNA amplification technology for the amplification of oligonucleotides ref name Wang2010 cite journal last Wang first Xiaolong coauthors Deming Gou, Shuang yong Xu title Polymerase Endonuclease Amplification Reaction PEAR for Large Scale Enzymatic Production of Antisense Oligonucleotides journal PLoS ONE date January 1, 2010 year 2010 month January volume 5 issue 1 pages 7 doi 10.1371 journal.pone.0008430 pmid 20062528 url http www.plosone.org article info doi 10.1371 journal.pone.0008430 accessdate 22 August 2011 pmc 2797076 ref . A target oligonucleotide and a tandem repeated antisense probe are subjected to repeated cycles of denaturing, annealing, elongation and cleaving, in which thermostable DNA polymerase elongation and strand slipping generate duplex tandem repeats, and thermostable endonuclease PspGI cleavage releases monomeric duplex oligonucleotides. PEAR has the potential to be a useful tool for Large scale production of oligonucleotides. PEAR is a minimal DNA replication system, so it can be considered as a minimal life system. it is of therectical interests to study the origin and evolution of repetitive DNA. The repetitive DNA products can be transferred directly into cells or organisms to study the function of the repetitive DNA. References Reflist Category DNA replication ...   more details



  1. BsuBI/PstI restriction endonuclease

    lead rewrite date July 2011 Infobox protein family Symbol BsuBI PstI RE Name BsuBI PstI RE image width caption structure of sdai restriction endonuclease Pfam PF06616 Pfam clan InterPro IPR009528 SMART PROSITE MEROPS SCOP TCDB OPM family OPM protein CAZy CDD In molecular biology, the BsuBI PstI restriction endonuclease family is a family of type II restriction endonucleases. It includes BsuBI and PstI . The enzymes of the BsuBI restriction modification R M system recognise the target Nucleotide sequence sequence 5 CTGCAG and are functionally identical with those of the PstI R M system. ref name pmid1480472 cite journal author Xu GL, Kapfer W, Walter J, Trautner TA title BsuBI an isospecific restriction and modification system of PstI characterization of the BsuBI genes and enzymes journal Nucleic Acids Res. volume 20 issue 24 pages 6517 23 year 1992 month December pmid 1480472 pmc 334566 doi 10.1093 nar 20.24.6517 url ref References reflist InterPro content IPR009528 Category Protein families ...   more details



  1. DpnII restriction endonuclease family

    Infobox protein family Symbol DpnII Name DpnII image width caption Pfam PF04556 Pfam clan CL0236 InterPro IPR007637 SMART PROSITE MEROPS SCOP TCDB OPM family OPM protein CAZy CDD In molecular biology, the DpnII restriction endonuclease family is a family of restriction endonucleases which includes DpnII from Diplococcus pneumoniae . These enzymes recognise the double stranded DNA unmethylated Nucleotide sequence sequence GATC and cleave before G 1, where it encompasess the full length of the protein. ref name pmid11133943 cite journal author Sekizaki T, Otani Y, Osaki M, Takamatsu D, Shimoji Y title Evidence for horizontal transfer of SsuDAT1I restriction modification genes to the Streptococcus suis genome journal J. Bacteriol. volume 183 issue 2 pages 500 11 year 2001 month January pmid 11133943 pmc 94905 doi 10.1128 JB.183.2.500 511.2001 url ref References reflist InterPro content IPR007637 Category Protein families ...   more details



  1. Endonuclease/Exonuclease/phosphatase family

    Pfam box Symbol Exo endo phos Name Endonuclease Exonuclease phosphatase family image PDB 1ako EBI.jpg width caption Structure of the multifunctional DNA repair enzyme exonuclease III. ref name pmid7885481 cite journal author Mol CD, Kuo CF, Thayer MM, Cunningham RP, Tainer JA title Structure and function of the multifunctional DNA repair enzyme exonuclease III journal Nature volume 374 issue 6520 pages 381 6 year 1995 month March pmid 7885481 doi 10.1038 374381a0 url ref Pfam PF03372 InterPro IPR005135 SMART Prosite PDOC00598 SCOP 1ako TCDB CDD cd08372 OPM family 148 OPM protein 1zwx PDB PDB3 1i9y A 560 846 PDB3 1i9z A 560 846 PDB3 1si6 X 29 298 PDB3 1y21 A 29 298 PDB3 1ntf A 29 298 PDB3 1zwx A 45 332 PDB3 1ako 1 266 PDB3 1de9 A 62 316 PDB3 1de8 A 62 316 PDB3 1cqg B 62 70 PDB3 1dew A 62 316 PDB3 1cqh B 62 70 PDB3 1e9n A 62 316 PDB3 1hd7 A 62 316 PDB3 1bix 62 316 PDB3 1lyr A 62 316 PDB3 1xzs A 62 316 PDB3 1xzr A 62 316 PDB3 1xzt A 62 316 PDB3 1wdu B 56 180 PDB3 1sr4 B 27 281 PDB3 2a41 B 23 281 PDB3 1dnk A 23 281 PDB3 2a40 B 23 281 PDB3 2dnj A 23 281 PDB3 2a3z B 23 281 PDB3 3dni 23 281 PDB3 1atn D 23 281 PDB3 2a42 B 23 281 Endonuclease Exonuclease phosphatase family is a structural domain found in the large family of proteins including magnesium dependent endonucleases and many phosphatase s involved in intracellular signaling . ref name PUB00007746 cite journal author Dlaki M title Functionally unrelated signalling proteins contain a fold similar to Mg2 dependent endonucleases journal Trends Biochem. Sci. volume 25 issue 6 pages 272 273 year 2000 pmid 10838565 doi 10.1016 S0968 0004 00 01582 6 ref Examples AP endonuclease proteins EC number 4.2.99.18 , DNase I proteins EC number 3.1.21.1 , Synaptojanin , an inositol 1,4,5 trisphosphate phosphatase EC number 3.1.3.56 Sphingomyelinase EC number 3.1.4.12 and Nocturnin UniProt O35710 . Subfamilies Inositol polyphosphate related phosphatase InterPro IPR000300 Human proteins containing this domain 2 PDE 2 PDE ANGEL1 ANGEL2 ...   more details



  1. Restriction endonuclease BsobI/AvaI

    Infobox protein family Symbol Endonuc BsobI Name Endonuc BsobI image PDB 1dc1 EBI.jpg width caption restriction enzyme bsobi dna complex structure encirclement of the dna and histidine catalyzed hydrolysis within a canonical restriction enzyme fold Pfam PF09194 Pfam clan InterPro IPR015277 SMART PROSITE MEROPS SCOP 1dc1 TCDB OPM family OPM protein CAZy CDD In molecular biology, the restriction endonuclease BsobI AvaI family of enzymes includes the AvaI and BsoBI restriction endonucleases from Anabaena variabilis and Bacillus stearothermophilus , both of which recognise the double stranded Nucleotide sequence sequence CYCGRG where Y T C, and R A G and cleave after C 1. ref name pmid11250198 cite journal author van der Woerd MJ, Pelletier JJ, Xu S, Friedman AM title Restriction enzyme BsoBI DNA complex a tunnel for recognition of degenerate DNA sequences and potential histidine catalysis journal Structure volume 9 issue 2 pages 133 44 year 2001 month February pmid 11250198 doi 10.1016 S0969 2126 01 00564 0 url ref References reflist InterPro content IPR015277 Category Protein domains ...   more details



  1. DNA/RNA non-specific endonuclease

    Orphan date August 2011 Infobox protein family Symbol Endonuclease NS Name Endonuclease NS image PDB 1smn EBI.jpg width caption identification of the serratia endonuclease dimer structural basis and implications for catalysis Pfam PF01223 Pfam clan CL0263 InterPro IPR001604 SMART PROSITE PDOC00821 MEROPS SCOP 1smn TCDB OPM family OPM protein CAZy CDD In molecular biology, enzymes in the DNA RNA non specific endonuclease family of bacteria l and eukaryotic endonucleases EC number 3.1.30. share the following characteristics they act on both DNA and RNA , bond cleavage cleave double stranded and single stranded nucleic acid s and require a divalent ion such as magnesium for their activity. A histidine has been shown to be essential for the activity of the Serratia marcescens nuclease . This residue chemistry residue is located in a conserved sequence conserved region which also contains an aspartic acid residue that could be implicated in the binding of the divalent ion. ref name pmid8078761 cite journal author Friedhoff P, Gimadutdinow O, Pingoud A title Identification of catalytically relevant amino acids of the extracellular Serratia marcescens endonuclease by alignment guided mutagenesis journal Nucleic Acids Res. volume 22 issue 16 pages 3280 7 year 1994 month August pmid 8078761 pmc 523719 doi 10.1093 nar 22.16.3280 url ref References reflist InterPro content IPR001604 Category Protein domains ...   more details



  1. Flap structure-specific endonuclease 1

    PBB geneid 2237 Flap endonuclease 1 is an enzyme that in humans is encoded by the FEN1 gene . ref name pmid7774922 cite journal author Hiraoka LR, Harrington JJ, Gerhard DS, Lieber MR, Hsieh CL title Sequence of human FEN 1, a structure specific endonuclease, and chromosomal localization of the gene FEN1 in mouse and human journal Genomics volume 25 issue 1 pages 220 5 year 1995 month Jul pmid 7774922 pmc doi 10.1016 0888 7543 95 80129 A ref ref name entrez cite web title Entrez Gene FEN1 flap structure specific endonuclease 1 url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ShowDetailView&TermToSearch ... endonuclease 1 during long patch base excision repair provides coordinated loading of the proteins onto ... RAD2 endonuclease family and is one of ten proteins essential for cell free DNA replication ... structure specific endonuclease 1 has been shown to Protein protein interaction interact with Cyclin ... 2001 month Jun. title Regulation of human flap endonuclease 1 activity by acetylation through the transcriptional ... Ian D, Brosh Robert M year 2004 month Mar. title Stimulation of flap endonuclease 1 by the Bloom ... flap endonuclease 1 and stimulates its cleavage activity journal EMBO J. volume 20 issue 20 pages 5791 ... M S year 1997 month Sep. title The DNA repair endonuclease XPG binds to proliferating cell nuclear ... AP endonuclease 1 with flap endonuclease 1 and proliferating cell nuclear antigen involved in long ... flap endonuclease 1 is critical for substrate binding and catalysis. journal J. Biol. Chem. volume ... DNA structure specific endonuclease. journal EMBO J. volume 13 issue 5 pages 1235 46 year 1994 pmid ... acids for substrate binding and catalysis of human flap endonuclease 1. journal J. Biol. Chem. volume ... pmc 1169950 cite journal author Gary R, Ludwig DL, Cornelius HL, et al. title The DNA repair endonuclease ... of the DNA repair and replication endonuclease and exonuclease FEN 1 coupling DNA and PCNA binding ..., Hassa PO, et al. title Regulation of human flap endonuclease 1 activity by acetylation through the transcriptional ...   more details



  1. List of homing endonuclease cutting sites

    endonuclease . TOC Homing endonucleases The list includes some of the most studied examples. The following ... endonuclease Nomenclature Nomenclature in the article Homing endonuclease . SF Structural family Any ... see the section homing endonuclease Structural families Structural families in the article Homing endonuclease . PDB code Code used to identify the structure of a protein in the Protein Data Bank ... strand endonuclease that cleaves the homing site of this intron journal Curr Genet volume 19 issue ... cite journal author Marshall P, Lemieux C title Cleavage pattern of the homing endonuclease encoded ... rrnL gene of Chlamydomonas humicola encodes a site specific DNA endonuclease I ChuI journal ... author Turmel M, Mercier JP, C t V, Otis C, Lemieux C title The site specific DNA endonuclease ... by the LAGLIDADG homing endonuclease I CreI journal Mol. Cell volume 2 issue 4 month October pages ..., activity, and structure of a highly specific artificial endonuclease journal Mol. Cell volume 10 ... code br code 3 TCATTACTCGGATTGCGAGTCGTT Pad em Nicking endonuclease br code Pad 2em 3 TCATTACTCGGATTGC ... Pad em Nicking endonuclease br code Pad 2em 3 TCATTACTCGGATTGCGAGTTGTTN sub 35 sub ... type endonuclease from Pyrobaculum organotrophum journal Nucleic Acids Res pmid 7984405 volume 22 ... in the S.cerevisiae bi2 intron encoded RNA maturase is sufficient to gain a homing endonuclease activity ... pmid1534148 cite journal author Gimble FS, Thorner J title Homing of a DNA endonuclease gene by meiotic ... J, Banroques J, Jacq C title Site specific DNA endonuclease and RNA maturase activities of two homologous ... D, Tian GL, Lazowska J, Jacq C title A new specific DNA endonuclease activity in yeast mitochondria ... C title I Sce III a novel group I intron encoded endonuclease from the yeast mitochondria journal ... mitochondrial intron aI5 alpha associated endonuclease activity and in vivo mobility journal ... AM, Maley F title Characterization of the restriction site of a prokaryotic intron encoded endonuclease ...   more details



  1. Endodeoxyribonuclease

    Endodeoxyribonuclease is a endonuclease ribonuclease . Restriction enzyme s are a type of endodeoxyribonuclease. More examples Deoxyribonuclease I, Deoxyribonuclease II, Deoxyribonuclease IV, UvrABC endonuclease External links MeshName Endodeoxyribonucleases Nucleases hydrolase stub Category Ribonucleases ...   more details



  1. HEG

    NOTOC Wiktionary domain HEG may refer to Homing endonuclease genes , the genes that codes for the homing endonucleases Hydro erosive grinding , a process of calibration of machines that works with fluids disambig de HEG it HEG ...   more details



  1. NlaIII

    Unreferenced date December 2009 Orphan date November 2006 NlaIII is an endonuclease that cleaves double stranded DNA molecules into fragments, leaving leave 3 overhangs of four nucleotides at the ends of each fragment. DEFAULTSORT Nlaiii Category Genetics Category Molecular biology Category Biotechnology Category Restriction enzymes Genetics stub ...   more details



  1. Endodeoxyribonucleases

    Endodeoxyribonucleases are enzymes which are both deoxyribonuclease s and endonuclease s. They are classified with Enzyme Commission number EC numbers 3.1.21 through 3.1.25. Examples include restriction enzymes DNA restriction enzymes micrococcal nuclease External links MeshName Endodeoxyribonucleases Category EC 3.1 enzyme stub ...   more details



  1. DNA-(apurinic or apyrimidinic site) lyase

    WG date 1987 title Escherichia coli endonuclease III is not an endonuclease but a beta elimination ... journal author PH date 1988 title Mechanism of UV endonuclease V cleavage of abasic sites in DNA ...   more details



  1. Meganuclease I-SceI

    Orphan date February 2009 Meganuclease I Sce I is a homing endonuclease . It recognises an 18 base pair sequence TAGGGATAACAGGGTAAT and leaves a 4 base pair 3 hydroxyl overhang. It is a rare cutting endonuclease . Statistically an 18 bp sequence will occur once in every 6.9 10 sup 10 sup base pairs or once in 20 human genomes. ref http www.neb.com nebecomm products productR0694.asp New England Biolabs site ref Source I SceI is coded by intron s. It is present in the mitochondria of yeast Saccharomyces cerevisiae . References Reflist Category Molecular biology Category Biotechnology Category Restriction enzymes molecular cell biology stub ...   more details



  1. ENDOG

    Orphan date February 2009 PBB geneid 2021 Endonuclease G, mitochondrial is an enzyme that in humans is encoded by the ENDOG gene . ref name pmid7789991 cite journal author Tiranti V, Rossi E, Ruiz Carrillo A, Rossi G, Rocchi M, DiDonato S, Zuffardi O, Zeviani M title Chromosomal localization of mitochondrial transcription factor A TCF6 , single stranded DNA binding protein SSBP , and endonuclease G ENDOG , three human housekeeping genes involved in mitochondrial biogenesis journal Genomics volume 25 issue 2 pages 559 64 year 1995 month Jul pmid 7789991 pmc doi 10.1016 0888 7543 95 80058 T ref ref name entrez cite web title Entrez Gene ENDOG endonuclease G url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ShowDetailView&TermToSearch 2021 accessdate ref The PBB Summary template is automatically maintained by Protein Box Bot. See Template PBB Controls to Stop updates. PBB Summary section title summary text The protein encoded by this gene is a nuclear encoded endonuclease that is localized in the mitochondrion. The encoded protein is widely distributed among animals and cleaves DNA at GC tracts. This protein is capable of generating the RNA primers required by DNA polymerase gamma ... Characterization and expression of the mouse endonuclease G gene journal DNA Cell Biol. volume 16 ..., Luo X, Wang X title Endonuclease G is an apoptotic DNase when released from mitochondria journal Nature ... Ohsato T, Ishihara N, Muta T, et al. title Mammalian mitochondrial endonuclease G. Digestion of R ... of endonuclease G and apoptosis inducing factor journal Free Radic. Biol. Med. volume 36 issue ... immunodeficiency virus 1 Tat and gp120 Differential involvement of caspase 3 and endonuclease G journal ... RNase endonuclease G involvement of Hsp70 and ATP journal Apoptosis volume 10 issue 4 pages 821 30 ..., Yin X, et al. title Endonuclease G promotes cell death of non invasive human breast cancer cells journal ... endonuclease G, AIF, and AMID during apoptosis in human cells journal Apoptosis volume 12 issue ...   more details



  1. BpuJI

    Orphan date April 2012 Infobox protein family Symbol BpuJI N Name BpuJI N terminal domain image width caption crystal structure of restriction endonuclease bpuji recognition domain in complex with cognate dna Pfam PF11564 Pfam clan InterPro IPR021108 SMART PROSITE MEROPS SCOP TCDB OPM family OPM protein CAZy CDD In molecular biology, BpuJI is a type II restriction endonuclease which recognises the asymmetry asymmetric Nucleotide sequence sequence 5 CCCGT and cuts at multiple sites in the surrounding area of the target sequence. The BpuJI protein consists of two distinct modules an N terminal DNA recognition domain, and a C terminal dimerisation and catalysis domain. The N terminal domain is composed of two winged helix subdomains and a disrupted linker subdomain. Target sequence recognition occurs through major groove contacts of amino acid s in the winged helix subdomains. ref name pmid18433771 cite journal author Sukackaite R, Grazulis S, Bochtler M, Siksnys V title The recognition domain of the BpuJI restriction endonuclease in complex with cognate DNA at 1.3 A resolution journal J. Mol. Biol. volume 378 issue 5 pages 1084 93 year 2008 month May pmid 18433771 doi 10.1016 j.jmb.2008.03.041 url ref References reflist InterPro content IPR021108 Category Protein families Category Molecular biology Category Bacterial enzymes Category Restriction enzymes Category EC 3.1 ...   more details



  1. Endoribonuclease

    A Endoribonuclease is a ribonuclease endonuclease . It cleaves either single stranded or double stranded RNA , depending on the enzyme. Example includes both single proteins like RNase III , RNase A , RNase T1 , and RNase H , and also complexes of proteins with RNA like RNase P and the RNA induced silencing complex . External links MeshName Endoribonucleases hydrolase stub Nucleases Category Ribonucleases fr Endoribonucl ase ...   more details



  1. NdeI

    Notability date May 2009 Orphan date February 2009 NdeI is an endonuclease isolated from Neisseria denitrificans . In molecular biology , it is commonly used as a restriction enzyme . Recognition sequence of NdeI 5 CATATG 3 GTATAC How NdeI cuts this sequence 5 CA TATG 3 3 GTAT AC 5 Category Molecular biology Category Bacterial enzymes Category Restriction enzymes enzyme stub ...   more details



  1. Excinuclease

    Unreferenced stub auto yes date December 2009 Excision endonuclease , also known as excinuclease or UV Specific Endonuclease , is a nuclease enzyme which excises a fragment of nucleotides during DNA repair . The excinuclease cuts out a fragment by hydrolyzing two phosphodiester bonds, one on either side of the lesion in the DNA. This process is part of nucleotide excision repair , a mechanism that can fix specific damages to the DNA in the G1 phase of the eukaryotic cell cycle . Such damages can include the thymine dimers created by UV rays. A deficiency of excinuclease occurs in a rare autosomal recessive disease called xeroderma pigmentosum . Diagnosis of this disease is done by measuring the enzyme s level in white blood cells in a blood sample. Symptoms in children include extreme ultraviolet UV sensitivity, excessive freckle freckling , multiple skin cancer s and corneal ulcer ations. Typically, these symptoms are seen during a child s first sun exposure. Citation needed date November 2009 Category DNA repair Enzyme stub ca escinucleasa es escinucleasa ...   more details




Articles 1 - 25 of 294          Next


Search   in  
Search for Endonuclease in Tutorials
Search for Endonuclease in Encyclopedia
Search for Endonuclease in Videos
Search for Endonuclease in Books
Search for Endonuclease in Software
Search for Endonuclease in DVDs
Search for Endonuclease in Store


Advertisement




Endonuclease in Encyclopedia
Endonuclease top Endonuclease

Home - Add TutorGig to Your Site - Disclaimer

©2011-2013 TutorGig.info All Rights Reserved. Privacy Statement