Guanin.svg ImageSize1 150px ImageFileL2 Guanine 3D balls.png ImageFileR2 Guanine 3D vdW.png ImageSizeL2 ..., br 2 aminohypoxanthine, br Guanine Section1 Chembox Identifiers DrugBank Ref drugbankcite correct ... OtherCations OtherCpds Cytosine Adenine Thymine Uracil Guanine G, Gua is one of the four main nucleobase ... uracil in RNA . In DNA , guanine is paired with cytosine. With the formula C sub 5 sub H sub 5 sub N sub 5 sub O, guanine is a derivative of purine , consisting of a fused pyrimidine imidazole ring system with conjugated double bonds. Being unsaturated, the bicyclic molecule is planar. The guanine nucleoside is called guanosine . Basic principles Guanine, along with adenine and cytosine, is present in both DNA and RNA, whereas thymine is usually seen only in DNA, and uracil only in RNA. Guanine ... donor and the C 2 carbonyl and the N 3 amine as the hydrogen bond acceptors. Guanine has a group ... 250px The first isolation of guanine was reported in 1844 from the excreta of sea birds, ref cite journal last Hitchings first George H. coauthors Elvira A. Falco title The Identification of Guanine ... be converted to guanine. citation needed date September 2011 Guanine can be hydrolyzed with strong acid to glycine , ammonia , carbon dioxide , and carbon monoxide . Guanine is first deaminated to xanthine ... NetBiochem pupyr pp.htm accessdate 2008 03 27 ref Guanine oxidizes more readily than adenine, the other ... bonding, guanine is relatively insoluble in water, but it is soluble in dilute acids and bases. Syntheses Trace amounts of guanine form by the polymerization of ammonium cyanide chem NH ... 4 CN frozen at 20 C for 25 years gave a 0.0035 yield. These results indicate guanine could arise in frozen regions of the primitive earth. In 1984, Yuasa reported a 0.00017 yield of guanine after ... by a subsequent acid hydrolysis. However, it is unknown whether the presence of guanine was not simply ... L. Miller, John Or title Production of Guanine from NH4CN Polymerizations journal Journal of Molecular ... more details
enzyme Name guanine transporting ATPase EC number 3.6.3.37 CAS number IUBMB EC number 3 6 3 37 GO code 0008558 image width caption In enzymology , a guanine transporting ATPase EC number 3.6.3.37 is an enzyme that catalysis catalyzes the chemical reaction ATP H sub 2 sub O guanineout math rightleftharpoons math ADP phosphate guaninein The 3 substrate biochemistry substrates of this enzyme are adenosine triphosphate ATP , water H sub 2 sub O , and guanine , whereas its 3 product chemistry products are adenosine diphosphate ADP , phosphate , and guanine . This enzyme belongs to the family of hydrolase s, specifically those acting on acid anhydrides to catalyse transmembrane movement of substances. The systematic name of this enzyme class is ATP phosphohydrolase guanine importing . References reflist 1 cite journal author Dreesen TD, Johnson DH, Henikoff S year 1988 title The brown protein of Drosophila melanogaster is similar to the white protein and to components of active transport complexes journal Mol. Cell. Biol. volume 8 pages 5206&ndash 15 pmid 3149712 issue 12 pmc 365623 cite journal author Tearle RG, Belote JM, McKeown M, Baker BS, Howells AJ year 1989 title Cloning and characterization of the scarlet gene of Drosophila melanogaster journal Genetics. volume 122 pages 595&ndash 606 pmid 2503416 issue 3 pmc 1203733 cite journal author Griffiths JK and Sansom CE date title The Transporter Factsbook, Academic Press, San Diego, 1998 journal volume pages Category EC 3.6.3 Category Enzymes of unknown structure hydrolase stub ... more details
hypoxanthine inosine monophosphate guanine guanosine monophosphate often renamed as HGPRT. Performs .... In this role, catalyzes in the reaction between guanine and phosphoribosyl pyrophosphate PRPP ... DG, Dawson PA, Emmerson BT, Gordon RB title A review of the molecular basis of hypoxanthine guanine ... for human hypoxanthine guanine phosphoribosyltransferase HPRT deficiency journal Am. J. Hum. Genet ... R, Nuki G, Snyder FF title The point mutation of hypoxanthine guanine phosphoribosyltransferase HPRTEdinburgh ... journal author Sculley DG, Dawson PA, Beacham IR, et al. title Hypoxanthine guanine phosphoribosyltransferase ..., Palella TD, Kelley WN title Molecular basis of hypoxanthine guanine phosphoribosyltransferase deficiency ... for hypoxanthine guanine phosphoribosyltransferase HPRT Ann Arbor journal Hum. Genet. volume 79 issue ... M, Kelley WN, Palella TD title Human hypoxanthine guanine phosphoribosyltransferase deficiency ... TD title Identification of a single nucleotide change in the hypoxanthine guanine phosphoribosyltransferase ... more details
File GTP.png thumb Guanosine triphosphate GTP File Guanosindiphosphate.png thumb GDP Guanine nucleotide exchange factors GEFs activate monomeric GTPases by stimulating the release of guanosine diphosphate GDP to allow binding of guanosine triphosphate GTP . A variety of unrelated structural domain s have been shown to exhibit guanine nucleotide exchange activity. Some GEFs can activate multiple GTPases while others are specific to a single GTPase. Function File GTPase Activation.png thumb Schematic of GEF activation of a GTPase Guanine Nucleotide Exchange Factors GEFs are proteins involved in the activation of small GTPases . Small GTPases act as molecular switches in intracellular signaling pathways and have many downstream targets. The most well known GTPases comprise the Ras superfamily and are involved in essential cell processes such as cell differentiation and proliferation, cytoskeletal organization, vesicle trafficking, and nuclear transport. ref name Alberts et al 2002 cite book author Bruce Alberts et al title Molecular Biology of the Cell url http www.ncbi.nlm.nih.gov books NBK26822 A2855 accessdate 12 January 2011 year 2002 publisher Garland Science isbn 081533218 pages 877 ref GTPases are active when bound to GTP and inactive when bound to GDP, allowing their activity to be regulated by GEFs and the opposing GTPase activating proteins GAPs . ref name two Cite doi 10.1038 348125a0 ref GDP disassociates from inactive GTPases very slowly. ref name two The binding of GEFs to their GTPase substrates catalyzes the dissociation of GDP, allowing a GTP molecule to bind in its place. GEFs function to promote the dissociation of GDP. After GDP has disassociated from the GTPase ... is the guanine nucletoot change factor for Ran GTPase. It localizes to the nucleus and catalyzes the activation ... reflist See also Nucleotide exchange factor Guanine Small GTPases G proteins GTP binding protein regulators ... and gdis MBInfo Glossary Terms GAPs, GEFs, and GDIs DEFAULTSORT Guanine Nucleotide Exchange Factor Category ... more details
orphan date October 2011 Infobox protein family Symbol EF1 GNE Name EF1 GNE image PDB 2b7c EBI.jpg width caption yeast guanine nucleotide exchange factor eef1balpha k205a mutant in complex with eef1a Pfam PF00736 Pfam clan InterPro IPR014038 SMART PROSITE PDOC00648 MEROPS SCOP 1b64 TCDB OPM family OPM protein CAZy CDD In molecular biology, the EF1 guanine nucleotide exchange domain is a protein domain found in the beta and delta chains of elongation factors from eukaryote eukaryotes and archaea . EEF1B2 Elongation factor EF1B also known as EF Ts or EF 1beta gamma delta is a nucleotide exchange factor that is required to regenerate eEF 1 EF1A from its inactive form EF1A GDP to its active form EF1A GTP . EF1A is then ready to Protein protein interaction interact with a new aminoacyl tRNA to begin the cycle again. EF1B is more complex in eukaryotes than in bacteria, and can consist of three subunits EF1B alpha or EF 1beta , EF1B gamma or EF 1gamma and EF1B beta or EF 1delta . ref name pmid12762045 cite journal author Andersen GR, Nyborg J title Structural studies of eukaryotic elongation factors journal Cold Spring Harb. Symp. Quant. Biol. volume 66 issue pages 425 37 year 2001 pmid 12762045 doi url ref The EF1 guanine nucleotide exchange domain is found in the beta EF 1beta, also known as EF1B alpha and delta EF 1delta, also known as EF1B beta chains of EF1B protein s from eukaryote eukaryotes and archaea . The beta and delta chains have exchange activity, which mainly resides in their homologous guanine nucleotide exchange domains, found in the C terminal region of the peptide s. Their N terminal regions may be involved in interactions with the gamma chain EEF1G EF 1gamma . ref name pmid10368288 Cite pmid 10368288 ref References reflist InterPro content IPR014038 Category Protein domains ... more details
CDC25 can refer to Cdc25 , a cell division cycle protein Another name for ras GRF1 , a guanine nucleotide exchange factor Letter NumberCombDisambig Long comment to avoid listing on Special Shortpages............................................................................... more details
A phosphoribosyltransferase is a type of transferase enzyme. Types include Adenine phosphoribosyltransferase Hypoxanthine guanine phosphoribosyltransferase Orotate phosphoribosyltransferase Uracil phosphoribosyltransferase Glycosyltransferases Category Transferases enzyme stub ... more details
M349 Guanine G to Thymine T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct M356 M359 Thymine T to Cytosine C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt M365 Adenine A to Guanine G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M367 Adenine A to Guanine G 196 274 ccttcatttaggctgtagctgc ... M369 Guanine G to Cytosine C 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M370 Cytosine C to Guanine G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M405 See also Single nucleotide polymorphism ... more details
GNE may refer to GNE gene , a human gene Guanine nucleotide exchange factor GNE encyclopedia GNE , the encyclopedia previously known as GNUPedia Go North East , a bus operator in North East England disambig de GNE it GNE ... more details
from rabbit erythrocytes catalyzing the insertion of guanine into tRNA journal J. Biol. Chem. volume ... N, Ohgi T, Goto T, Nishimura S date 1980 title Transfer ribonucleic acid guanine transglycosylase isolated ... more details
A base analog is a chemical that can substitute for a normal nucleobase in nucleic acid s. A common example would be 5 bromouracil 5BU , the abnormal base found in the mutagenic nucleotide analog BrdU. When a nucleotide containing 5 bromouracil is incorporated into the DNA, it is most likely to pair with adenine however, it can spontaneously shift into another isomer which pairs with a different nucleobase , guanine . If this happens during DNA replication, a guanine will be inserted opposite the base analog, and in the next DNA replication, that guanine will pair with a cytosine. This results in a change in one base pair of DNA, specifically a Transition genetics transition mutation . Image 5bu 2.gif center thumb 500px Mutagenesis by 5BU See also Antimetabolite References Griffiths AJ, Wessler SR, Lewontin RC, Gelbart WM, Suzuki DT, Miller JH. Introduction to Genetic Analysis , 8th ed. New York W.H.Freeman and Co, 2005. Category DNA Category Genetics de Basenanaloga zh ... more details
Pentosyltransferases are a type of glycosyltransferase that catalyze the transfer of a pentose . Examples include adenine phosphoribosyltransferase hypoxanthine guanine phosphoribosyltransferase pertussis toxin poly ADP ribose polymerase They are classified under Enzyme Commission number EC number 2.4.2. External links MeshName Pentosyltransferases Glycosyltransferases enzyme stub Category EC 2.4.2 ... more details
DISPLAYTITLE C sub 5 sub H sub 5 sub N sub 5 sub O The molecular formula C sub 5 sub H sub 5 sub N sub 5 sub O molar mass 151.13 g mol may refer to Guanine Isoguanine MolFormDisambig sr C5H5N5O ... more details
FYVE, RhoGEF and PH domain containing FGD is a gene family consisting of FGD1 FGD2 FGD3 FGD4 Type 1 is associated with Aarskog Scott syndrome . See also Guanine nucleotide exchange factor External links MeshName FGD1 protein, human MeshName FGD2 protein, human Category Genes biochem stub GTP binding protein regulators ... more details
Refimprove auto yes date December 2009 Image Cytosine chemical structure.png Cytosine 100px right Cytosine Image Thymine chemical structure.png Thymine 100px right Thymine Image Uracil chemical structure.png Uracil 100px right Uracil Image Adenine chemical strucfture.png Adenine 100px right Adenine Image Guanine chemical structure.png Guanine 100px right Guanine A nitrogenous nitrogen containing base is a nitrogen containing molecule having the chemical properties of a base. It is an organic compound that owes its property as a Base chemistry base to the lone pair of electron s of a nitrogen atom . In biological science s, nitrogenous bases are typically classified as the derivatives of two parent compounds, pyrimidine and purine . ref Nelson and Cox 2008, p. 272. ref They are non polar and due to their aromaticity , planar. Both pyrimidines and purines resemble pyridine and are thus weak bases and relatively unreactive towards electrophilic aromatic substitution . ref Carey 2006, p. 1206. ref Their flat shape is particularly important when considering their roles in nucleic acids as nucleobase s building blocks of DNA and RNA adenine , guanine , thymine , cytosine , and uracil . These nitrogenous bases hydrogen bond between opposing DNA strands to form the rungs of the twisted ladder or double helix of DNA or a biological catalyst that is found in the nucleotides. Adenine is always paired with thymine, and guanine is always paired with cytosine. Uracil is only present in RNA replacing thymine and pairing with adenine. Notes Reflist References Nelson, David L. and Michael M. Cox 2008 . Principles of Biochemstry , ed. 5, W.H. Freeman and Company. Carey, Francis A. 2008 . Organic Chemistry , ed. 6, Mc Graw Hill. DEFAULTSORT Nitrogenous Base Category Biochemistry Biochemistry stub ar ca Base nitrogenada es Base nitrogenada eo Nitrogena bazo gl Base nitroxenada lt Nukleobaz pt Base nitrogenada th tr Azotlu baz zh ... more details
A salvage pathway is a Metabolic pathway pathway in which nucleotide s purine and pyrimidine are synthesized from intermediates in the degradative pathway for nucleotides. Salvage pathways are used to recover bases and nucleosides that are formed during biodegradation degradation of RNA and DNA . This is important in some organs because some tissues cannot undergo de novo synthesis . The salvaged bases and nucleosides can then be converted back into nucleotides. Substrates The salvage pathway requires distinct substrates Pyrimidines Uridine phosphorylase adds ribose 1 phosphate to the free base uracil, forming uridine monophosphate. Uridine kinase then phosphorylates this nucleoside into its diphosphate and triphosphate forms. Deoxythymidine phosphorylase adds deoxyribose 1 phosphate to thymine, forming deoxythymidine monophosphate. Thymidine kinase can then phosphorylate this compound to deoxythymidine diphosphate and triphosphate. Image Pyrimidine Ribonucleotide Salvage.png thumb none 400px The salvage of pyrimidine ribonucleotides. Purines Phosphoribosyltransferases add activated ribose 5 phosphate called phosphoribosyl pyrophosphate or PRPP to bases, creating nucleotide monophosphates. There are two types of phosphoribosyltransferases adenine phosphoribosyltransferase APRT and hypoxanthine guanine phosphoribosyltransferase HGPRT . Lesch Nyhan syndrome is associated with a deficiency of HGPRT. class wikitable Nucleoside Enzyme Nucleotide hypoxanthine hypoxanthine guanine phosphoribosyl transferase HGPRT Inosine monophosphate IMP guanine hypoxanthine guanine phosphoribosyl transferase HGPRT Guanosine monophosphate GMP adenine adenine phosphoribosyltransferase APRT Adenosine monophosphate AMP External links http www.chem.brandeis.edu pochapsky research.html Enzymes in the methionine salvage pathway structure and function at Brandeis University Category Genetics genetics stub Protein metabolism Nucleotide metabolism ca Salvament de nucle tids de Salvage Pathway ja ... more details
High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria ref NCBI Taxonomy browser, http www.ncbi.nlm.nih.gov Taxonomy Browser wwwtax.cgi?mode Undef&id 201174&lvl 3&lin f&keep 1&srchmode 1&unlock, accessed 3 13 07. ref . For more information, see GC content . References references bacteria stub Category Microbiology ... more details
Vav is a family of proteins involved in cell signalling . They act as guanine nucleotide exchange factors GEFs for small G protein s of the Rho family . GEF activity is mediated via module of tandem RhoGEF domain DH PH domain PH domains. Vav proteins also appear to exhibit GEF independent functions. There are three members of this family VAV1 Vav1 VAV2 Vav2 VAV3 Vav3 protein stub Category Protein families de Vav Proteine ... more details
EF Ts elongation factor thermo stable is one of the prokaryotic elongation factors . EF Ts serves as the guanine nucleotide exchange factor for EF Tu elongation factor thermo unstable , catalyzing the release of guanosine diphosphate from EF Tu. This enables EF Tu to bind to a new guanosine triphosphate molecule, release EF Ts, and go on to catalyze another aminoacyl tRNA addition. GeneticTranslation Category Protein biosynthesis enzyme stub ... more details
GRR or grr may refer to ANOVA gauge R&R , gauge repeatability and reproducibility, a statistical measure of the precision of a measurement system Great River Road , a series of roads which follow the Mississippi River Gerald R. Ford International Airport , IATA code GRR, in Grand Rapids, Michigan Grand Rapids Amtrak station , station code GRR, in Grand Rapids, Michigan Agroar Trabalhos A reos , ICAO airline code GRR, based in Portugal The Taznatit language, ISO 639 3 code Glycine rich region, a stretch of a protein containing multiple copies of the amino acid glycine Grothendieck Riemann Roch theorem see Grothendieck Hirzebruch Riemann Roch theorem . Guanine rich region, a stretch of DNA containing multiple copies of the nucleotide guanine Grr, an onomatopoeia for growling , also spelled grrr See also Grrr disambiguation disambig de GRR fr GRR it GRR ... more details
enzyme Name guanosine phosphorylase EC number 2.4.2.15 CAS number 9030 28 8 IUBMB EC number 2 4 2 15 GO code 0047975 image width caption In enzymology , a guanosine phosphorylase EC number 2.4.2.15 is an enzyme that catalysis catalyzes the chemical reaction guanosine phosphate math rightleftharpoons math guanine alpha D ribose 1 phosphate Thus, the two substrate biochemistry substrates of this enzyme are guanosine and phosphate , whereas its two product chemistry products are guanine and alpha D ribose 1 phosphate . This enzyme belongs to the family of glycosyltransferase s, specifically the pentosyltransferases. The systematic name of this enzyme class is guanosine phosphate alpha D ribosyltransferase . This enzyme participates in purine metabolism . References reflist 1 cite journal author Yamada EW year 1961 title The phosphorolysis of nucleosides by rabbit bone marrow journal J. Biol. Chem. volume 236 pages 3043&ndash 3046 pmid 14008731 Category EC 2.4.2 Category Enzymes of unknown structure enzyme stub ... more details
O sup 6 sup alkyl guanine transferase II O sup 6 sup AGT II previously known as O sup 6 sup Guanine transferase ogt is a protein that is involved in DNA repair with Ada protein Ada . ref name Friedberg cite book title DNA Repair and Mutagenesis edition 2 last Friedberg first Errol authorlink coauthors Graham C. Walker, Wolfram Siede, Richard D. Wood , Roger A. Schultz, Tom Ellenberger year 2006 publisher ASM Press location Washington, DC isbn 1 55581 319 4 OCLC 59360087 pages ref Like Ada, AGT II is responsible for the removal of alkyl groups from O sup 6 sup alkyl guanine , O sup 4 sup alkyl thymine and alkyl phosphotriester in the sugar phosphate backbone of DNA. ref name Friedberg AGT II shows a greater preference for O sup 4 sup alkyl thymine than O sup 6 sup alkyl guanine and alkyl phosphotriester. ref name Friedberg ref name Sassanfar Sassanfar M, Dosanjh MK, Essigmann JM, Samson L. Relative efficiencies of the bacterial, yeast, and human DNA methyltransferases for the repair of O sup 6 sup methylguanine and O sup 4 sup methylthymine. Suggestive evidence for O sup 4 sup methylthymine repair by eukaryotic methyltransferases. J Biol Chem. 1991 Feb 15 266 5 2767 71. PMID 1993655. ref Unlike Ada, AGT II is expressed constitutively in cells. ref name Friedberg ref name Rebeck Rebeck GW, Samson L. Increased spontaneous mutation and alkylation sensitivity of Escherichia coli strains lacking the ogt O6 methylguanine DNA repair methyltransferase. J Bacteriol. 1991 Mar 173 6 2068 76. PMID 2002008. ref Therefore, AGT II will repair alkylated DNA adduct s even before Ada is fully induced. AGT II is similar to Ada in its Suicide inhibition suicide inactivation in that AGT II transfers the alkyl group to a cysteine residue in its own structure, thereby inactivating itself. ref name Friedberg The human equivalent of AGT II is MGMT O sup 6 sup methyl guanine methyl transferase . MGMT preferentially removes alkyl groups from O sup 6 sup alkyl guanine than from O sup 4 sup alkyl ... more details
The B recognition element BRE is a DNA sequence found in the promoter region of most genes in eukaryote s and Archaea . ref name Lagrange cite journal author Lagrange T, Kapanidis AN, Tang H, Reinberg D, Ebright RH year 1998 journal Genes and Development volume 12 issue 1 pages 34 44 title New core promoter element in RNA polymerase II dependent transcription sequence specific DNA binding by transcription factor IIB pmid 9420329 doi 10.1101 gad.12.1.34 pmc 316406 ref ref cite journal journal Proceedings of the National Academy of Sciences of the USA title The structural basis for the oriented assembly of a TBP TFB promoter complex year 1999 author Littlefield O, Korkhin Y, Sigler PB volume 96 issue 24 pages 13668 13673 pmid 10570130 doi 10.1073 pnas.96.24.13668 pmc 24122 ref The BRE is a cis regulatory element that is found immediately upstream of the TATA box , and consists of 7 nucleotide s. The BRE was discovered in 1998 by Richard H. Ebright Richard Ebright and co workers ref name Lagrange Overview The first two nucleotides of the BRE sequence can be either guanine or cytosine . The third nucleotide is either guanine or adenine . The next four nucleotides are always the same cytosine, guanine, cytosine, cytosine. G C G C G A C G C C. The Transcription Factor IIB TFIIB recognizes this sequence in the DNA, and binds to it. The fourth and fifth alpha helix alpha helices of TFIIB intercalate with the DNA Grooves major groove of the DNA at the BRE. TFIIB is one part of the Transcription preinitiation complex preinitiation complex that helps RNA Polymerase II bind to the DNA. See also Promoter biology CAAT box Enhancer genetics Insulator genetics Initiator element Transcription start site References reflist Transcription Category Regulatory sequences genetics stub ... more details
Encyclopedia
top
