Pp semi small yes pp move indef Infobox haplogroup name R1b map HaplogroupR1bYDNA .jpg origin date ... , Bashkirs File Distribution HaplogroupR1bYDNA version 2.gif 300px thumb Approximate distribution of HaplogroupR1b in Europe In human genetics , HaplogroupR1b is the most frequently occurring ... R1b is a sub clade within the much larger Eurasian Haplogroup MNOPS YDNA MNOPS macro haplogroup ... Society of Genetic Genealogy ISOGG YDNAHaplogroup R and its Subclades ref Also prior to 2002, major ..., and this whole group, along indeed with all of Haplogroup F YDNA macro haplogroup F , is believed to have originated in Asia. Clade label1 Haplogroup MNOPS YDNA Macro haplogroup MNOPS 1 Clade 1 Haplogroup M YDNAHaplogroup M . New Guinea , Melanesia , eastern Indonesia , and Polynesia . label2 Haplogroup NO YDNA Macro haplogroup NO 2 Clade 1 Haplogroup N YDNAHaplogroup N . Mainly found in North Asia and northeastern Europe. 2 Haplogroup O YDNAHaplogroup O . Mainly found in East Asia, Southeast Asia, and Austronesia . label3 Haplogroup P YDNA Macro haplogroup P 3 Clade 1 Haplogroup Q YDNAHaplogroup Q . Mainly found in North Asia and the Americas. label2 Haplogroup R YDNA Macro haplogroup R 2 Clade label1 Haplogroup R1 YDNA Macro haplogroup R1 1 Clade 1 Haplogroup R1a YDNAHaplogroup ... found in Western Europe, Central Africa and South West Asia. 2 Haplogroup R2 YDNAHaplogroup R2 . Mainly found in South Asia. 4 Haplogroup S YDNAHaplogroup S . New Guinea , Melanesia , and eastern ... of Germany, Ireland and the USA while 2 were in Haplogroup G YDNA G2a Haplogroup G2a . ref ... . See also Haplogroup R1b1b2a1a2c YDNA This subclade is defined by the presence of the marker M167 ... improve the resolution within Y chromosome haplogroupR1b in a central European population sample ... of a parallel mutation that also exists inside haplogroupHaplogroup I2 YDNA I2a1 I2a1 L159.1 . L159.2 ... R1 YDNA R1 descendants R1b1a R P297 , R1b1b R M335 , R1b1c R V88 mutations 1. M343 defines ... more details
YDNA J , HaplogroupR1bYDNAR1b , and Haplogroup T YDNA T . Distribution Because Haplogroup IJK YDNA IJK is a subclade of F , it is the most common macro haplogroup outside of Africa with more than ... West and South Eurasia R1a and R1b are the most common Hgs in Europe Haplogroup S YDNA S Found in Melanesia ... South Asia or Southwest Asia ancestor Haplogroup CF YDNA CF descendants F , F1, F2, F3, F4, F5, Haplogroup G YDNA G , Haplogroup H YDNA H , Haplogroup IJK YDNA IJK mutations P14, M89, M213, P133, P134 ... DNAhaplogroupY chromosome haplogroup spanning all the continents. This haplogroup and its subclade ... haplogroup G YDNA G M201 , haplogroup H YDNA H M69 , and haplogroup IJK YDNA IJK L15 S137 ... Haplogroup CF YDNA C F chromosome may have been carried out of Africa very early in the modern human ... originated in or near India , and F might share a common demographic history with Haplogroup H YDNA H , Haplogroup C YDNA C5 , Haplogroup R2 YDNA R2 and Haplogroup L YDNA L1 . ref name Sengupta cite ... Haplogroup E YDNA E , Haplogroup A YDNA A , Haplogroup B YDNA B predominate, as well as parts of Eastern Asia and Oceania , where Haplogroup C YDNA C and Haplogroup D YDNA D are most common ... for the mutation that defines F. ref http www.familytreedna.com public F YDNA The Haplogroup F YDNA .... In India it is distributed similarly to Haplogroup H YDNA H . ref name Chiaroni cite journal ... published research. Haplogroup CF YDNA CF F P14 , M89 , M213, P133, P134, P135, P136, P138, P139 ... year 2009 pmid 19573232 pmc 2720951 doi 10.1186 1471 2148 9 154 ref Haplogroup G YDNA G M201 Throughout Eurasia but predominantly in the Caucasus . Haplogroup H YDNA H M69, M370 Typical for the Indian subcontinent . Haplogroup IJK YDNA IJK L15 S137, L16 S138 Haplogroup IJ YDNA IJ M429 P125, P123, P124, P126, P127, P129, P130, S2, S22 Haplogroup I YDNA I Native to and found mostly in Europe Haplogroup J YDNA J The most common YDNAhaplogroup in Near East Haplogroup K YDNA K M9, P128, P131 ... more details
Infobox haplogroup name R2 map origin date 25,000 ybp origin place South Asia or Central Asia ancestor Haplogroup R YDNA R descendants R2 and Haplogroup R2a YDNA R2a mutations M479 members n a Haplogroup R2 is a Human Y chromosome DNA haplogroups Y chromosome haplogroup characterized by genetic marker ... vaop ncurrent abs ejhg2010146a.html A major Y chromosome haplogroupR1b Holocene era founder effect in Central and Western Europe 2010 . ref This SNP now defines Haplogroup R2, while the known M124 SNP now defines Haplogroup R2a YDNAHaplogroup R2a . The 2010 Y Chromosome Phylogenetic Tree was updated ... YDNAHaplogroup R and its Subclades 2010 . ref Note Before the discovery of the M479 SNP, the M124 SNP used to define Haplogroup R2. Subclades Clade label1 Haplogroup R2 1 Clade label1 Paragroup R2 1 label2 Haplogroup R2a YDNA Haplogroup R2a 2 Paragroup R2 Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined ... center 0.071 center Haplogroup R2a Haplogroup R2a YDNAHaplogroup R2a is a Human Y chromosome DNA haplogroups Y chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly ... Haplogroup R2 is a subgroup of Haplogroup R YDNAHaplogroup R M207 R M207 R R1 M306 R2 M479 R2 R2a M124, P249, P267, L266, PAGES00004, L381 R2a R2a1 L295 R2a2 L263 YDNA Description of the M479 SNP ... http www.familytreedna.com public R2 R2 Y Chromosome HaplogroupDNA Project http www.r2dna.org Digging into Haplogroup R2 YDNA http www.familytreedna.com public R2 M124 WTY R2 M124 WTY Walk Through the Y Project http www.familytreedna.com public R Arabia R Arabia YDNA Project http sites.google.com ... Haplogroup R2 YDna Category Human YDNA haplogroups R2 Category Human evolution ca Haplogrup ... by an asterisk placed after the main haplogroup. Y chromosomes which are positive to the M479 SNP ... M479 ref name myres scope row style background efefef YCC Haplogroup R2 scope row style background ... more details
Underhill et al. 2009 ref R1b Main HaplogroupR1bYDNAHaplogroupR1b probably originated in Eurasia ... haplogroup tree ref origin place Central Asia or South Asia ancestor haplogroup R YDNA R descendants haplogroup R1a YDNA R1a , haplogroupR1bYDNAR1b mutations M173 ref http isogg.org tree ISOGG HapgrpR08.html YDNAHaplogroup R and its Subclades 2008 from ISOGG ref In human genetics , Haplogroup R1 is a Human Y chromosome DNAhaplogroupY chromosome DNAhaplogroup , a subgroup of haplogroup R YDNAhaplogroup R , associated with the M173 mutation. It is dominated in practice by two very ... East . Looking at R1 s relatives more generally, haplogroup R YDNAhaplogroup R is part of the family of haplogroup P YDNAhaplogroup P , and a sibling clade, therefore, of haplogroup Q YDNAhaplogroup ... Wells et al. 2001 being also worthy of consideration. Distribution Image Haplogroup R YDNA ... nodes of the YDNA tree down to and including M207 which defines Haplogroup R but which display ... after Haplogroup Q YDNA Q , especially in North America in Ojibwe people at 79 , Chipewyan 62 ... Genealogy ISOGG ref http www.isogg.org tree Main06.html ISOGG Website ref Haplogroup R YDNA R R1 ... in Middle East and South Asia haplogroup R1a YDNA R1a L62 M513, L63 M511, L145 M449, L146 M420 ... YDNAR1b M343 R1b R1b1 P25, L278 R1b1 R1b1a V88 The majority was found in northern and central Africa ... Image YHaplogroup R1 distribution.png thumb 250px Distribution of R1a purple and R1b red Haplogroup ... National Geographic Society ref R1a Main Haplogroup R1a YDNA The highest levels of R1a 50 are found ... 10244.pdf See also Human Y chromosome DNAhaplogroup Genealogical DNA test Prehistoric Europe Y chromosome ... PMC379223 Reduced Y Chromosome, but Not Mitochondrial DNA, Diversity in Human Populations from West ... of haplogroupR1b especially R1b1a2, R M269 , is the most common haplogroup in Western Europe ... Americas see also Indigenous Amerindian genetics YDNA haplogroups in Indigenous peoples of the Americas ... more details
Infobox haplogroup name CF map Yhaplotree.JPG origin date 55,000 60,000years BP origin place Southwest Asia ancestor Haplogroup CT YDNA CT descendants Haplogroup C YDNA C , Haplogroup F YDNA F mutations P143 In human genetics , Haplogroup CF also known as CF xDE is a human male Human Y chromosome DNA haplogroups YDNAHaplogroup defined by the SNP P143. Along with and parallel to Haplogroup DE YDNAHaplogroup DE , it is a descendant of Haplogroup CT YDNAHaplogroup CT . As its compound name implies, it is the ancestral haplogroup to both Haplogroup C YDNAHaplogroup C and Haplogroup F YDNAHaplogroup F . ref cite journal author Underhill PA, Kivisild T title Use of Y chromosome and mitochondrial DNA population structure in tracing human migrations journal Annu. Rev. Genet. volume 41 pages 539 64 year 2007 pmid 18076332 doi 10.1146 annurev.genet.41.110306.130407 url http arjournals.annualreviews.org doi abs 10.1146 annurev.genet.41.110306.130407?url ver Z39.88 2003&rfr id ori rid crossref.org&rfr dat cr pub 3dncbi.nlm.nih.gov ref The haplogroup is hypothetical because no male in haplogroup CF has yet been discovered. References reflist YDNA Category Human YDNA haplogroups CF es Haplogrupo CF ADN Y ... more details
Haplogroup F YDNAHaplogroup F descendants Haplogroup IJ YDNA IJ , Haplogroup K YDNA K mutations ... DNA haplogroups human Y chromosome DNAhaplogroup . Haplogroup IJK is a descendant branch of the macrohaplogroup Haplogroup F YDNA F with Haplogroup IJ YDNAhaplogroup IJ and Haplogroup K YDNA ... published research. IJK IJK L15 S137, L16 S138, L69.1 G S163.1 Haplogroup IJ YDNA IJ M429 P125, P123, P124, P126, P127, P129, P130, S2, S22 Haplogroup K YDNA K M9, P128, P131, P132 Some of the main ... Clade 1 Haplogroup IJ label1 Haplogroup IJ YDNAHaplogroup IJ 1 Clade 1 Haplogroup I label1 Haplogroup I YDNAHaplogroup I 1 Clade 1 Haplogroup I1. Northern Europe . 2 Haplogroup I2. Scattered around Europe 2 Haplogroup J label2 Haplogroup J YDNAHaplogroup J 2 Clade 1 Haplogroup J1 YDNAHaplogroup J1 . Middle East . 2 Haplogroup J2 YDNAHaplogroup J2 . Middle East . 2 Haplogroup K label2 Haplogroup K YDNAHaplogroup K 2 Clade 1 Haplogroup L YDNAHaplogroup L . South Asia . label2 Haplogroup MNOPS YDNA Macro haplogroup MNOPS 2 Haplogroup MNOPS 2 Clade 1 Haplogroup M YDNAHaplogroup M . New Guinea , Indonesia , Melanesia and Polynesia . label2 Haplogroup NO YDNA Macro haplogroup NO 2 Clade 1 Haplogroup N YDNAHaplogroup N . Mainly found in Northern Asia , Northern Europe , and Eastern Europe . 2 Haplogroup O YDNAHaplogroup O . Mainly found in East Asia , Southeast Asia , and Oceania . label3 Haplogroup P YDNA Macro haplogroup P 3 Clade 1 Haplogroup Q YDNAHaplogroup Q . Mainly found in Northern Asia and the Americas . label2 Haplogroup R YDNA Macro haplogroup R 2 Clade 1 Haplogroup R1 YDNA Macro haplogroup R1 . Europe , parts of Central Asia , South Asia , West Asia , and in parts of Africa such as Cameroon . 2 Haplogroup R2 YDNAHaplogroup R2 . Mainly found in South Asia . 4 Haplogroup S YDNAHaplogroup S . New Guinea , Indonesia and Melanesia . 3 Haplogroup T YDNAHaplogroup T . Found in the Near East and parts of Africa , among the Ethiopians, Somali and Upper ... more details
R1a YDNA R1a1a M17 and HaplogroupR1bYDNA R1b1b2 M269. ref name Semino2000 Harvcolnb Semino et .... ref name Underhill et al. 2009 Harvcoltxt Underhill et al. 2009 ref R1b Main HaplogroupR1bYDNA ...Infobox haplogroup name R map Haplogroup R YDNA .jpg origin date 26,800 19,900 34,300 years ago ref ... Asia ancestor haplogroup P YDNA P which origin is believed to be in west central Asia descendants R , Haplogroup R1 YDNA R1 , haplogroup R2 YDNA R2 mutations R M207 UTY2 , P224, P227, P229, P232, P280, P285, S4, S8, S9 and V45. ref name ISOGG 2010 br Haplogroup R1 YDNA R1 M173 br haplogroup R1a YDNA R1a L62, L63 br haplogroupR1bYDNAR1b M342 br haplogroup R2 YDNA R2 M479 br haplogroup R2a YDNA R2a L266, M124, P249, and P267. members In human genetics , haplogroup R is a Human Y chromosome DNAhaplogroupY chromosome DNAhaplogroup very common throughout Europe , Central Asia and South ... YDNAhaplogroup P and it is defined by the M207 single nucleotide polymorphism SNP mutation . Origins ... in Central Asia or South Asia, where its ancestor haplogroup P YDNAHaplogroup P is most often ... R 1 label2 Haplogroup R1 YDNA Haplogroup R1 2 Clade 1 Paragroup R1 2 Clade label1 Haplogroup R1a YDNA Haplogroup R1a 1 Clade 1 Paragroup R1a 2 Haplogroup R1a1 YDNA Haplogroup R1a1 3 Clade label1 HaplogroupR1bYDNA Haplogroup R1b 1 Clade 1 Paragroup R1b 2 Haplogroup R1b1 YDNA Haplogroup R1b1 label3 Haplogroup R2 YDNA Haplogroup R2 3 Clade 1 Paragroup R2 2 Clade label1 Haplogroup R2a YDNA Haplogroup R2a 1 Clade 1 Paragroup R2a 2 Haplogroup R2a1 YDNA Haplogroup R2a1 Distribution ... . ref R1 Image Haplogroup R YDNA .PNG thumb 350px Spread of Haplogroup R in Native populations ... R1 YDNA The majority of members of haplogroup R belong to its subgroup R1, defined by marker ... haplogroup in Indigenous peoples of the Americas following Haplogroup Q YDNAhaplogroup Q , and spreads ... more details
Infobox haplogroup name E1 map origin date 45,000 50,000 years BP origin place Africa ancestor Haplogroup E YDNA E descendants Haplogroup E1a YDNA E1a , Haplogroup E1b YDNA E1b mutations L504, L511, P147 In human genetics , Haplogroup E1 P147 is a human Y chromosome DNAhaplogroup . Haplogroup E1, along with Haplogroup E2 YDNAhaplogroup E2 , is one of the two main branches of the older Haplogroup E YDNAHaplogroup E . The E1 clade is divided into two clades subclades Haplogroup E1a YDNA E1a & Haplogroup E1b YDNA E1b . YDNA External links http www.isogg.org tree ISOGG HapgrpE08.html YDNAHaplogroup E and Its Subclades from ISOGG 2008 Category Human YDNA haplogroups E Genetics stub ca Haplogrup E del cromosoma Y hum de Haplogruppe E YDNA es Haplogrupo E ADN Y fr Haplogroupe E Y ADN ru E1 Y ... more details
Western Europe , Southwest Asia , and southern Siberia HaplogroupR1bYDNAR1b M343 Typical ... R1b R1b1 P25 Haplogroup R2 YDNA R2 M124 Typical of populations of South Asia , with a moderate ... IJK YDNA IJK descendants K , haplogroup K xLT YDNA K xLT , and haplogroup LT YDNA LT mutations M9, P128, P131, P132 In human genetics , Haplogroup K M9 is a Human Y chromosome DNAhaplogroup . This haplogroup is a descendant of Haplogroup IJK YDNAHaplogroup IJK . Its major descendant haplogroups are Haplogroup LT L298 P326 and Haplogroup K xLT YDNAHaplogroup K xLT M525 . ref http ... YDNAhaplogroup K is an old lineage established approximately 40,000 50,000 years ago whose origins ... classes of subgroups 1 major groups L to T refer to the main tree at YDNAHaplogroup Tree and 2 minor ... L YDNAHaplogroup L . South Asia , Central Asia , West Asia . 2 Haplogroup T YDNAHaplogroup T . Scattered ... , South and East India and Upper Egypt . label3 Haplogroup K xLT YDNA Macro haplogroup K xLT 3 Haplogroup K xLT 3 Clade 1 Haplogroup M YDNAHaplogroup M . New Guinea , Indonesia , Melanesia and Polynesia . label2 Haplogroup NO YDNAHaplogroup NO 2 Clade 1 Haplogroup N YDNAHaplogroup N . Mainly found in Northern Asia , Northern Europe , and Eastern Europe . 2 Haplogroup O YDNAHaplogroup O . Mainly found in East Asia , Southeast Asia , and Oceania . label3 Haplogroup P YDNAHaplogroup P 3 Clade 1 Haplogroup Q YDNAHaplogroup Q . Mainly found in Northern Asia and the Americas . label2 Haplogroup R YDNAHaplogroup R 2 Clade 1 Haplogroup R1 YDNA Macro haplogroup R1 . Europe , parts of West Asia , Central Asia , South Asia , North America , and Africa . 2 Haplogroup R2 YDNAHaplogroup R2 . Mainly found in South Asia , parts of Central Asia and West Asia . 4 Haplogroup S YDNAHaplogroup ... 2006 ISOGG tree . The former subgroups K2 and K5 were renamed Haplogroups Haplogroup T YDNA T and Haplogroup S YDNA S the old subgroups K1 and K7 were re assigned as new subgroups M2 and M3 of a redefined ... more details
Infobox haplogroup name Q1a3 map origin date origin place Eurasia ancestor Q1a descendants Q1a3a, Q1a3b mutations L56, L57, M346 members Haplogroup Q1a3 is a subclade of YDNAHaplogroup Q YDNAHaplogroup Q . Haplogroup Q1a3 is defined by the presence of the M346 Single Nucleotide Polymorphism SNP and may therefore be referred to as Q M346 in shorthand . Distribution Q1a3 was first thought to be isolated to India ref A novel subgroup Q5 of human Y chromosomal haplogroup Q in India http www.ncbi.nlm.nih.gov pmc articles PMC2258157 . ref but has since been detected in the Middle East, ref Saudi Arabian Y Chromosome diversity and its relationship with nearby regions http www.biomedcentral.com 1471 2156 10 59 ref Europe Citation needed date September 2011 and the Americas. ref Restricted geographic distribution for Y Q paragroup in South America http www3.interscience.wiley.com journal 122506765 abstract. ref Associated SNP s Q1a3 is marked by the presence of the M346 SNP. Since the discovery of M346 several additional SNP s have been found to also be associated with Q1a3. These SNP s include L56 and L57. These SNP s appear to be parallel to M346. ref Family Tree DNA Draft Haplogroup Q Tree http ytree.ftdna.com index.php?name Draft&parent 31182976. ref Subgroups The International Society of Genetic Genealogy ISOGG defines the subgroups of Q1a3 as the following ref ISOGG 2010 Haplogroup Q Tree http www.isogg.org tree ISOGG HapgrpQ.html ref Haplogroup Q1a3a L53, L54, L55 Haplogroup Q1a3a1 YDNAHaplogroup Q1a3a1 M3 Haplogroup Q1a3a1a M19 Haplogroup Q1a3a1b M194 Haplogroup Q1a3a1c M199, P106, P292 Haplogroup Q1a3b M323 See also Human Y chromosome DNAhaplogroupHaplogroup Q YDNAHaplogroup Q Haplogroup Q1a3a1 YDNAHaplogroup Q1a3a1 YDNA References references External links http www.familytreedna.com public yDNA Q The YDNAHaplogroup Q Project DEFAULTSORT Haplogroup Q1a3 YDna Category Human YDNA haplogroups Q1a3 ... more details
Infobox haplogroup name BT map YDNA tree.GIF origin date 70,000 80,000 years BP origin place Africa ancestor Haplogroup A YDNA A2 T descendants Haplogroup B YDNA B , Haplogroup CT YDNA CT mutations Page65.1 SRY1532.1 SRY10831.1, M42, M91, M94, M139, M299, P97, V21, V29, V31, V59, V64, V102, V187, V202, V216, V235 In human genetics , Haplogroup BT SRY10831.1 SRY1532.1 , M42, M94, M139, M299 is a Human Y chromosome DNAhaplogroupY chromosome haplogroup . ref ISOGG 2011, http www.isogg.org tree ISOGG YDNATreeTrunk.html YDNAHaplogroup Tree ref The notation BT refers to the derived set of haplogroups between B and T which forms its own cladistic set. Haplogroup BT is descended from Haplogroup A YDNAHaplogroup A2 T about 70,000 years Before Present bp , possibly originating in western North Africa or central West Africa . It contains the remaining living human YDNA haplogroups from macro haplogroup A. References references YDNA Category Human YDNA haplogroups BT bioinformatics stub ca Haplogrup BR del cromosoma Y hum es Haplogrupo BT ADN Y fr Haplogroupe BT Y ADN ... more details
Haplogroup R2 YDNA R2 descendants R2a , Haplogroup R2a1 YDNA R2a1 , R2a2 mutations M124, P249 ... YDNAHaplogroup R and its Subclades 2010 . ref ref name PAGES00004 FTDNA s Draft phylogeny tree ... R2a is a Human Y chromosome DNA haplogroups Y chromosome haplogroup characterized by genetic ... ejhg2010146a.html A major Y chromosome haplogroupR1b Holocene era founder effect in Central and Western Europe 2010 . ref Before the publication of the 2005 Y Chromosome Phylogenetic Tree, Haplogroup R2a was known as Haplogroup P1 and formerly thought to be a sister clade of Haplogroup R YDNAHaplogroup ... R2a1 YDNAHaplogroup R2a1 label3 3 Haplogroup R2a2 YDNAHaplogroup R2a2 Paragroup R2a Paragroup ... to Paragroup R2a . Haplogroup R2a1 Haplogroup R2a1 YDNAHaplogroup R2a1 is a Y chromosome haplogroup ... so far. Haplogroup R2a2 Haplogroup R2a2 YDNAHaplogroup R2a2 is a Y chromosome haplogroup characterized ... . ref name manoukian It is also reported in Caucasus and Central Asia . Haplogroup R2a YDNA CITEREFManoukian2006 ... center 10.17 align center 16.28 center Haplogroup R2a, along with haplogroups Haplogroup H YDNA H , Haplogroup L YDNA L , Haplogroup R1a1 YDNA R1a1 , and Haplogroup J2 YDNA J2 , forms the majority ... ejhg journal vaop ncurrent abs ejhg2010146a.html A major Y chromosome haplogroupR1b Holocene era ... and related SNPs Haplogroup R2a is a subgroup of Haplogroup R2 YDNAHaplogroup R2 M479 R2 M479 R2 ... R2 R2 Y Chromosome HaplogroupDNA Project http www.r2dna.org Digging into Haplogroup R2 YDNA http ... r2 frequency r2 frequencies worldwide?pli 1 List of R2 frequency DEFAULTSORT Haplogroup R2a YDna ... placed after the main haplogroup. Y chromosomes which are positive to the M124, P249, P267 ... 35 to 55 among non Brahmin castes of this region. Haplogroup R2a comprises 53 of Y chromosomes among ... Frequency of Haplogroup R2a in the Arab World from DNA studies width 110px Count width 110px Sample ... 1 align center 147 align center 0.68 center In the R2 M124 WTY and R Arabia YDNA Projects, ref ... more details
sources date August 2009 In human genetics, Haplogroup O2 P31, M268 is a Y chromosome DNAhaplogroup. br Haplogroup O2 is a descendent branch of the greater Haplogroup O YDNAHaplogroup O . Distribution Although Haplogroup O2 is not found so frequently in modern human populations as its brother clade, Haplogroup O3 YDNAHaplogroup O3 , it is notable for the peculiarities of its geographical distribution. Like all clades of Haplogroup O, Haplogroup O2 is found only among the males of modern Eastern Eurasia n populations. However, unlike Haplogroup O3, which is shared in common by almost all populations of Eastern Eurasia as well as many populations of Oceania , Haplogroup O2 is generally found only among certain populations, such as the Austroasiatic peoples of India, Bangladesh and Southeast Asia, the Nicobarese of the Nicobar Islands in the Indian Ocean, and the Koreans , Japanese people Japanese , and southern Tungusic peoples in China . Besides its widespread and patchy distribution, Haplogroup O2 is also notable for the fact that it can be divided into two major subclades that show almost completely disjunct distribution. One of these subclades, Haplogroup O2a YDNAHaplogroup O2a M95 , is found among some mostly tribal populations of South and Southeast Asia, as well as among the Khmer people Khmers of Cambodia and the Balinese people Balinese of Indonesia . The other major subclade, HaplogroupHaplogroup O2b YDNA O2b SRY465, M176 , is found almost exclusively among the Japanese people Japanese , Koreans , and Manchu people Manchurians . Sources http www.calabriadna.com ydna haplogroup descriptions.htm YDNAHaplogroup Descriptions See also Human Y chromosome DNA haplogroups YDNA Category Human YDNA haplogroups O2 genetics stub ... more details
Infobox haplogroup name E1b map origin date 40000 years BP origin place Africa ref name semino2004 http www.pubmedcentral.nih.gov articlerender.fcgi?artid 1181965& Origin, Diffusion, and Differentiation of Y Chromosome Haplogroups E and J ref ancestor Haplogroup E1 YDNA E1 descendants Haplogroup E1b1 YDNA E1b1 , E1b2 mutations P177 In human genetics , Haplogroup E1b P177 is a human Y chromosome DNAhaplogroup . Haplogroup E1b, along with Haplogroup E1a YDNAhaplogroup E1a , make up the two main components of the older Haplogroup E1 YDNA E1 . So far there are no attested exempliars of E1b . The clade is dominated by subclade E1b1 E P2 or E PN2 , which is by far the most frequent. Another subclade of E1b, E1b2 P75 , was announced in Hammer et al. 2003 and confirmed as a sibling to E1b1 in Karafet et al. 2008 . Tree This phylogenetic tree of haplogroup subclades is based on the YCC 2008 tree ref Karafet et al. 2008 ref and subsequent published research. E1b P177 Haplogroup E1b1 YDNA E1b1 P2, P179, P180, P181, DYS391p Haplogroup E1b1a YDNA E1b1a L222.1, V38, V100 Haplogroup E1b1b YDNA E1b1b M215 Page40 E1b2 P75 YDNA References reflist 2 External links http www.isogg.org tree ISOGG HapgrpE08.html YDNAHaplogroup E and Its Subclades from ISOGG 2008 http www.britishislesdna.com British Isles DNA Project Category Human YDNA haplogroups E ca Haplogrup E del cromosoma Y hum de Haplogruppe E YDNA es Haplogrupo E ADN Y fr Haplogroupe E Y ADN ru E1b Y ... more details
haplogroupR1bYDNAHaplogroup R1b1 18 23kya , which has been observed with especially high frequency among the members of some tribes in northern Cameroon , and Haplogroup T YDNAHaplogroup T 25 ... or Asia ancestor Haplogroup CT YDNA CT descendants Haplogroup D YDNA D , Haplogroup E YDNA E mutations ... DE is a human Y chromosome DNAhaplogroup . It is defined by the single nucleotide polymorphism SNP ... can be categorized as being in either Haplogroup D YDNA , which likely originated in Asia , the only place where it has been found, ref name Karafet or Haplogroup E YDNAhaplogroup E , which is believed ... was based on the fact that older African lineages, such as Haplogroup A YDNA haplogroups A and Haplogroup B YDNA B , were YAP negative whereas the younger lineage, Haplogroup E YDNAhaplogroup ... M174 mutation that defines haplogroup D YDNAhaplogroup D . The M174 allele is found in the ancestral ... to Africa, and at the time of writing that there was no unequivocal Y chromosome YDNA , mitochondrial DNA or autosomal DNA evidence of a back migration to Africa. ref name underhill Although haplogroup C YDNAHaplogroup C seems to have originated in Asia at a similar time to Haplogroup DE s origin .... DE M1 YAP, M145 P205 , M203, P144, P153, P165, P167, P183 Haplogroup D YDNA D M174, 021355 Haplogroup E YDNA E SRY4064, M96, P29, P150, P152, P154, P155, P156, P162 YDNA See also Haplogroup D YDNAHaplogroup E YDNA References reflist External links DEFAULTSORT Haplogroup De YDna Category Human YDNA haplogroups DE Category Human evolution ca Haplogrup DE del cromosoma Y hum es Haplogrupo ... reshape and increase resolution of the human Y chromosomal haplogroup tree journal Genome Research ... P, et al. title Phylogeographic analysis of haplogroup E3b E M215 y chromosomes reveals multiple ... Y chromosome haplogroup tree gaining new insights into human ancestry ref Peter Underhill states ... cite journal author Underhill PA, Kivisild T title Use of y chromosome and mitochondrial DNA ... more details
Sforza ref ancestor Haplogroup BT YDNA BT descendants Haplogroup CF YDNA CF and Haplogroup DE YDNA DE mutations P9.1, M168, M294, V9, V41, V54, V189, and V226 In human genetics , Haplogroup CT ... human male lines except haplogroup A YDNA A and haplogroup B YDNA B , which are both found almost ... of CT are in one of two major sub clades, Haplogroup CF YDNA CF and Haplogroup DE YDNA DE .... Citation needed date September 2010 In turn, DE is divided into an Asian haplogroup D YDNAhaplogroup D and a predominantly Africa distributed haplogroup E YDNAhaplogroup E , while CF is divided into an East Asian, American, and Oceanian haplogroup C YDNAhaplogroup C and haplogroup F YDNA ... Haplogroup CF YDNAHaplogroup CF P143 Haplogroup C YDNAHaplogroup C M130, M216 Found in Asia , Oceania , and North America Haplogroup C1 YDNAHaplogroup C1 M8, M105, M131 Found in Japan Haplogroup C2 YDNAHaplogroup C2 M38 Found in Indonesia , New Guinea , Melanesia , Micronesia , and Polynesia Haplogroup C3 YDNAHaplogroup C3 M217, P44 Found throughout Eurasia and North America, but especially ... speaking peoples Haplogroup C4 YDNAHaplogroup C4 M347 Found in the indigenous Australians indigenous peoples of Australia Haplogroup C5 YDNAHaplogroup C5 M356 Found in South Asia , Central Asia , and Southwest Asia Haplogroup F YDNAHaplogroup F M89, M213 Found throughout Eurasia , Oceania , and Americas the Americas F1 P91, P104 F2 M427, M428 F3 P96 F4 P254 Haplogroup G YDNA M201, P257 Found in Europe , Western Asia , Central Asia , South Asia , and North Africa Haplogroup H YDNA M69, M370 ... Asia , North Africa and East Africa Haplogroup I YDNA M170, M258, P19, P38, P212, U179 Found in Europe Haplogroup J YDNA 12f2.1, M304 Found in Europe , Western Asia , North Africa and East Africa Haplogroup K YDNA M9 Found all over Eurasia , North Africa , Oceania , East Africa , and the Americas Haplogroup LT YDNA L298 P326 Haplogroup L YDNA M11, M20, M22, M61, M185, M295 Found in the Indian ... more details
A first7 E first8 M first9 A ref origin place Pyrenees ancestor Haplogroup R1b1b2a1a2 YDNA R1b1b2a1a2 mutations M167 SRY2627 members Catalans In human genetics , Haplogroup R1b1a2a1a1b5a M167 , formerly known as R1b1b2a1a2c or R1b1b2a1b3 and previously R1b1c6 , is a Y chromosome Y chromosome haplogroup which is a subdivision of haplogroupR1bYDNAhaplogroupR1b defined by the presence of the marker ... 15 15 17 18 References reflist YDNA DEFAULTSORT Haplogroup R1b1b2a1a2c YDna Category Human YDNA haplogroups R Category Genetics Category DNA ... barrier in Iberia, suggested by analysis of a Y chromosomal DNA polymorphism. volume 65 issue ...Infobox haplogroup name R1b1b2a1a2c map YDNAR1b SRY2627.jpg origin date 1,650 to 3,450 or 1,000 to 2,650 years BP ref name Hurles1999 cite journal pmid 10521311 pmc 1288297 doi 10.1086 302617 year 1999 last1 Hurles first1 ME last2 Veitia last3 Arroyo last4 Armenteros last5 Bertranpetit last6 P rez Lezaun ... by FamilyTreeDNA . Distribution The first author to test for this marker long before current haplogroup ... Adojaan last5 Alavantic last6 Amorim last7 Amos last8 Armenteros last9 Arroyo title Y chromosomal diversity ... D first6 A first7 W first8 M first9 E ref also tested for that same marker, naming the haplogroup ... Bertranpetit title High resolution analysis of human Y chromosome variation shows a sharp discontinuity ... J ref However a study in 2005 of Spanish Basques found lower levels of this haplogroup than those recorded ... in the European Y chromosome diversity landscape , European Journal of Human Genetics 2005 13, pp .... It found the highest levels of this haplogroup in Catalonia. ref name Adams2008 cite journal pmid ... a high levels of this haplogroup in the central and eastern Pyrenees . The highest level ... and post neolithic genetic substrates in Iberia evidence from Y chromosome in Pyrenean populations ... men tested, Beleza et al. showed low levels of this haplogroup described in the paper as R1b3f in all ... more details
Infobox haplogroup name I map Haplogroup I YDNA .PNG origin date 25,000 30,000 years BP origin place Europe or Southwest Asia ancestor Haplogroup IJ YDNA IJ descendants Haplogroup I1 YDNA I1 , Haplogroup I2 YDNA I2 mutations M170, M258, P19, P38, P212, U179 members Bosnia and Herzegovina 65 , Bosnia ... I the letter I, not the number 1 is a Human Y chromosome DNAhaplogroupY chromosome DNAhaplogroup , a subgroup of haplogroup IJ YDNAhaplogroup IJ , itself a derivative of Haplogroup IJK YDNAHaplogroup IJK . YDNAHaplogroup I is predominantly a European haplogroup today. It represents ... name Rootsi2004 Middle East and Caucasus. Haplogroup I1 YDNA I1 M253 L64, L75, L80, L81, L118, L121 ... on subclades see Haplogroup I2 YDNAHaplogroup I2 Note that the naming of some of the subgroups has ... areas approach only around 45 of the population. Main Haplogroup I1 YDNA Image with unknown ... regarding YDNAHaplogroup I2b2 L38 have concluded that there was some Late Iron Age migration of Celtic ... 5 3 cagctcctcttttcaactctca See also Haplogroup Human Y chromosome DNA haplogroups Haplogroup I1 YDNAHaplogroup I2 YDNA References reflist 2 Notes refbegin cite journal author Bara L, Perici M, Klari ..., http www.isogg.org tree ISOGG HapgrpI.html YDNAHaplogroup I and its Subclades refend External links Phylogenetic tree and distribution maps http www.isogg.org tree ISOGG HapgrpI08.html YDNAHaplogroup ... http www.genebase.com tutorial item.php?tuId 12 Frequency Distributions of YDNAHaplogroup I and its ... I Tree K. Nordtvedt 2011 . Mailing Lists http archiver.rootsweb.com th index YDNAHAPLOGROUP I YDNAHAPLOGROUP I Archives http lists.rootsweb.com index other DNAYDNAHAPLOGROUP I.html YDNAHAPLOGROUP ... site haplogroupil38 Haplogroup I L38 I2b2 In Search of the Origin of I L38 aka I2b2 YDNA DEFAULTSORT Haplogroup I YDna Category Human YDNA haplogroups I Category Human evolution ca Haplogrup ... populations. Haplogroup I Y chromosomes have also been found among some populations of the Near East ... more details
s, as Haplogroup O3 YDNAHaplogroup O3 , which is the most common haplogroup among the Han Chinese and also generally found among Southeast Asian populations, becomes dominant. Haplogroup D1 continues ... also Haplogroup D YDNAYDNA Category Human YDNA haplogroups D genetics stub ... to provide the story with some independent corroboration. As for the ultimate origin of Haplogroup D1, one can only speculate that it might share a recent common ancestor with the Haplogroup D M174 Y ...Unreferenced date August 2007 Infobox haplogroup name D1 map origin date origin place ancestor Haplogroup D YDNA D descendants D1a mutations M15 members In human genetics , Haplogroup D1 M15 is a Human Y chromosome DNAhaplogroupY chromosome DNAhaplogroup . Haplogroup D1 is a descendant branch of the greater Haplogroup D YDNAHaplogroup D . Its phylogenetically closest relatives are found among the peoples of Japan , Central Asia , and the Andaman Islands in the Bay of Bengal . It is more distantly related to the Haplogroup E YDNAHaplogroup E , whose sub clades are common throughout Africa , West Asia , and Europe . Distribution Haplogroup D1 is widely distributed throughout populations that dwell to the northwest, north, northeast, east, and southeast of the Himalayas Himalaya . It is not found among the populations of India to the south and southwest. The distribution of Haplogroup D1 in Southeast Asia is also very limited, as it is found there only at low frequency and only among populations that speak Tibeto Burman languages Tibeto Burman or Hmong Mien languages Miao Yao languages, which have ancestral ties to the north. The distribution of Haplogroup D1 is much more regular in the north, as it is found among nearly all the populations of Central Asia and Northeast Asia ... of Haplogroup D1 occurs as one approaches the Tibetan Plateau Qinghai Tibetan Plateau ..., minor spike in the frequency of Haplogroup D1 occurs again in Korea , where it may reach as high ... more details
Infobox haplogroup name R2a1 map origin date n a origin place n a ancestor Haplogroup R2a YDNA R2a descendants R2a1 , R2a1a mutations L295 ref name isogg ISOGG 2011 , http www.isogg.org tree ISOGG HapgrpR.html YDNAHaplogroup R and its Subclades 2011 . ref ref name PAGES00004 FTDNA s Draft phylogeny tree, http ytree.ftdna.com index.php?name Draft&parent 99812970 FTDNA s Draft phylogeny tree . ref members n a Haplogroup R2a1 is a Human Y chromosome DNA haplogroups Y chromosome haplogroup characterized by genetic marker L295, ref name isogg ref name PAGES00004 and is found in Qatar, India, Armenia, Turkey, Italy, and United Kingdom so far. Subclades Clade label1 Haplogroup R2a1 1 Clade label1 1 Paragroup R2a1 label2 2 Haplogroup R2a1a Paragroup R2a1 Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional Unique event polymorphism unique markers . They are typically represented by an asterisk placed after the main haplogroup. Y chromosomes which are positive to the L295 SNP and negative to the L294 SNP, are categorized as belonging to Paragroup R2a1 . So far, it is found in Italy , India , and within the Simpson family. ref name R2 WTY R2 M124 WTY Walk Through the Y Project, http www.familytreedna.com public R2 M124 WTY R2 M124 WTY Walk Through the Y Project . ref Haplogroup R2a1a It is represented by the L294 SNP and found in Armenia and Turkey so far. ref name R2 WTY Notes references External links http www.familytreedna.com public R2 R2 Y Chromosome HaplogroupDNA Project http www.r2dna.org Digging into Haplogroup R2 YDNA http www.familytreedna.com public R2 M124 WTY R2 M124 WTY Walk Through the Y Project DEFAULTSORT Haplogroup R2a1 YDna Category Human YDNA haplogroups R2a1 Category Human evolution ... more details
Infobox haplogroup name IJ map Haplogroup IJ YDNA .jpg origin date 35,000 40,000 years BP Citation needed date August 2011 origin place Southwest Asia ancestor Haplogroup IJK YDNA IJK descendants Haplogroup I YDNA I , Haplogroup J YDNA J mutations M429 P125, P123, P124, P126, P127, P129, P130, S2, S22 In human genetics , Haplogroup IJ is a Human Y chromosome DNA haplogroups human Y chromosome DNAhaplogroup . Haplogroup IJ is a descendant branch of Haplogroup IJK YDNAHaplogroup IJK ref http www.isogg.org tree ISOGG YDNATreeTrunk08.html ISOGG Y tree showing HG IJK ref which in turn derives from the greater Haplogroup F YDNAHaplogroup F . Descendants are Haplogroup I YDNAHaplogroup I and Haplogroup J YDNAHaplogroup J . Haplogroup IJ derived populations account for a significant fraction ... 18385274 issue 5 pmc 2336805 T ref Subclades Image Distribution Haplogroup I Y DNA.svg 300px thumb Haplogroup I Distribution Image Distribution Haplogroup J Y DNA.svg 300px thumb Haplogroup J Distribution IJ M429, P123, P124, P125, P126, P127, P129, P130, S2, S22 per ISOGG 2008 Haplogroup I YDNA I M170, P19, M258, P38, P212, U179 Haplogroup I notation updated to ISOGG 2008 I Haplogroup I1 YDNA ... Haplogroup J YDNA J 12f2.1, M304, S6, S34, S35 J Haplogroup J1 YDNA J1 M267 Typical of populations ... and East Africa J1 J1a M62 J1b M365 J1c M367, M368 J1d M369 J1e M390 Haplogroup J2 YDNA J2 M172 ... Y chromosome DNA haplogroups YDNA haplogroups by ethnic groups Haplogroup I YDNAHaplogroup I1 YDNAHaplogroup I2 YDNAHaplogroup J YDNAHaplogroup J2 YDNAYDNA DEFAULTSORT Haplogroup Ij YDna Category Human YDNA haplogroups IJ Category Human evolution hi ru IJ .... Origin It is notable that no example of a Haplogroup IJ haplogroupY chromosome has been found ... resolution of the human Y chromosomal haplogroup tree journal Genome Research year 2008 volume ... YDNA I2 M438 P215 S31 formerly I1b I2 I2a P37.2 formerly I1b1 Typical of the South Slavs South Slavic ... more details
mutations M3 rs3894 members In human genetics , Haplogroup Q1a3a1 YDNA small phylogenetic name small and or Q M3 small mutational name small is a Human Y chromosome DNAhaplogroupY chromosome DNAhaplogroupYDNA . ref name Genebase cite web title Learn about YDNAHaplogroup Q work Wendy Tymchuk ... such as single nucleotide polymorphisms, or SNPs. These SNPs mark the branch of a haplogroup, and indicate that all descendents of that haplogroup at one time shared a common ancestor. The YDNA SNP ... history of indigenous peoples of the Americas YDNA haplogroups in Indigenous peoples of the Americas Haplogroup Q1a3a1 is one of the few Y Chromosome haplogroup strictly associated with the indigenous peoples of the Americas, along with haplogroupHaplogroup C3 YDNA C3b P39 which is almost exclusively ... American populations ref name subclades See also Human Y chromosome DNAhaplogroupHaplogroup Q YDNAHaplogroup Q Haplogroup Q1a3 YDNAHaplogroup Q1a3 YDNA References references External links http www.familytreedna.com public Amerind 20Y The YDNAHaplogroup Q1a3a American Indian Project http www.qydna.org The YDNAHaplogroup Q Project http www.genebase.com learning article 16 Learn about YDNAHaplogroup Q DEFAULTSORT Haplogroup Q1a3a1 YDna Category Human YDNA haplogroups Q1a3a ca Haplogrup ... within a haplogroup, leading to new lineages. These new lineages are considered subclades of the haplogroup. Each time a new mutation occurs, there is a new branch in the haplogroup, and therefore a new subclade. Haplogroup Q, possibly the youngest of the 20 Y chromosome haplogroups, originated with the SNP mutation M242 in a man from Haplogroup P that likely lived in Siberia approximately 15,000 to 20,000 years before present ref Haplogroup Q1a3a1 is a subclade of Haplogroup Q YDNAHaplogroup ...Infobox haplogroup name Q1a3a1 map origin date 10 to 15 thousand years ago origin place North America ... of Haplogroup Q url http 64.40.115.138 file lu 6 52235 NTIyMzV9K3szNTc2Nzc .jpg?download 1 publisher ... more details
Rootsi ancestor Haplogroup MNOPS YDNA MNOPS descendants Haplogroup N YDNA N , Haplogroup O YDNA O and NO mutations M214, P188, P192, P193, P194, P195. members In human genetics , Haplogroup NO M214 is a Human Y chromosome DNA haplogroups human Y chromosome DNAhaplogroup . Haplogroup NO is a descendant branch of the greater Haplogroup MNOPS YDNAHaplogroup MNOPS also known as K xLT and a phylogenetic sibling of haplogroup M YDNAHaplogroup M , Haplogroup P YDNAHaplogroup P , and haplogroup S YDNAHaplogroup S . Origins The M214 mutation that defines Haplogroup NO occurred in a gamete of a man who belonged to Haplogroup MNOPS YDNAHaplogroup MNOPS and who probably lived somewhere in Eurasia ... ancestor of a very large percentage of present day humans, as he is the forefather of both Haplogroup N YDNAHaplogroup N and Haplogroup O YDNAHaplogroup O , which together are overwhelmingly ... gatherer and farmer Y chromosomes, The Japan Society of Human Genetics, Springer Verlag 2005 ref Haplogroup NO M214 xN1 LLY22g, O M175 YDNA also has been found sporadically in samples of Han Chinese ..., P192, P193, P194, P195 NO N M231 Haplogroup N YDNA Main N Article O M175, P186, P191, P196 Haplogroup O YDNA Main O Article References reflist See also Human Y chromosome DNAhaplogroup Genealogical DNA test Y chromosome haplogroups by populations YDNA External links Category Human YDNA haplogroups ... of the Y chromosome haplogroup N from Southeast Asia towards Europe, European Journal of Human Genetics ... New Binary Polymorphisms Reshape and Increase Resolution of the Human Y Chromosomal Haplogroup ...Infobox haplogroup name NO map origin date 34.600 4.700 years BP ref name Rootsi Rootsi, Siiri et al ... case of Haplogroup NO has been found among the males of present day human populations. However, NO M214 xN1 LLY22g, O M175 , which potentially may belong either to Haplogroup NO or to Haplogroup ... Underlies Y Chromosome Stratification Across Indonesia, MBE Advance Access published March 5 ... more details
DNA NO descendants O , haplogroup O1 YDNA O1 , haplogroup O2 YDNA O2 , haplogroup O3 YDNA O3 ... DNAhaplogroupY chromosome DNAhaplogroup . Haplogroup O is a close cladistic brother group with Haplogroup N YDNAHaplogroup N , and is one of several descendants of haplogroup K YDNAHaplogroup K the intermediates being haplogroup MNOPS YDNAHaplogroup MNOPS and haplogroup NO YDNAHaplogroup NO . Origins Haplogroup O is a descendant haplogroup of haplogroup NO YDNAHaplogroup NO M214 , and first ... or East Asia . ref name ISOGG http www.isogg.org tree ISOGG HapgrpO.html YDNAHaplogroup O and its ... tree of human Y chromosomes with haplogroup N YDNAHaplogroup N , which is common throughout North ... Asia , and Oceania . Among the subbranches of Haplogroup O are Haplogroup O1 YDNAHaplogroup O1 , Haplogroup O2 YDNAHaplogroup O2 , and Haplogroup O3 YDNAHaplogroup O3 . Paragroup O Haplogroup ... O2b YDNAHaplogroup O2b , which has been found in approximately 30 of many samples of Koreans ... O2 xO2a M95,O2b M176 , or Haplogroup O2b M176. Haplogroup O1 MSY2.2 main Haplogroup O1 YDNAHaplogroup ... O2 M268 main Haplogroup O2 YDNAHaplogroup O2a YDNAHaplogroup O2a M95 Found frequently among ... O2b YDNAHaplogroup O2b M176 Found frequently among Koreans , with a moderate distribution among Buryats ... Thais , and Vietnam ese. Haplogroup O3 M122 main Haplogroup O3 YDNA Found frequently among ... O M175 1 clade label1 Northern Asiatic Haplogroup O3 YDNA O3 M122 1 clade label1 Sino Tibetan languages Sino Tibetan Haplogroup O3 YDNA O3a3c M134 1 clade 1 Sinitic languages Sinitic Haplogroup O3 YDNA O3a3c1 M117 2 Tibeto ... 2 clade 1 clade label1 Austro Asiatic languages Austro Asiatic Haplogroup O2a YDNA O2a ... label2 Austro Tai languages Austro Tai Haplogroup O1 YDNA O1a M119 2 clade label1 ... group.php?gid 6153169411 Haplogroup O YDNA interest group on Facebook Category Human YDNA haplogroups ... more details
Infobox haplogroup name I2 map origin date probably 15 kya see subclade descriptions origin place Southeastern Europe ancestor Haplogroup I YDNA I descendants I2 , I2a, I2b see subclade descriptions mutations ... th read YDNAHAPLOGROUP I 2010 04 1270925314 Russian I2a2a Dinaric TMRCA, 2010.04.10 by Ken Nordtvedt ... th read YDNAHAPLOGROUP I 2008 05 1211058850 Ken Nordtvedt The Lichtenstein cave ydna haplotypes ... of current population DNA. See also YDNAHaplogroup Human Y chromosome DNA haplogroups Haplogroup I YDNAHaplogroup I1 YDNA References reflist External links http hpgl.stanford.edu publications AJHG 2004 v75 Semino.pdf Phylogeography of Y Chromosome Haplogroup I Rootsi 2004 http mbe.oxfordjournals.org ... British Isles DNA Project Relationship to haplogroups and subclades YDNAYDNA I DEFAULTSORT Haplogroup I2 YDna Category Human YDNA haplogroups I2 Category Human evolution ca Haplogrup I1b del ... genetics , Haplogroup I2 is a Y chromosome haplogroup . Until 2008, it was known as Haplogroup I1b . Haplogroup I2 might have originated in Southeastern Europe some 15,000 17,000 years ago and developed ... I2 YDNA I2 M438 L68, M438 P215 S31 I2 Low frequency in Armenia , Georgia country Georgia and Turkey ... Phylogeography of Y Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe ... pdf33 rootsi33.pdf Y chromosome haplogroup I prehistoric gene flow in Europe , Documenta Praehistorica ... Phylogeography of Y Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric ... Underhill et al., New phylogenetic relationships for Y chromosome haplogroup I Reappraising its Phylogeography ...., http www.familytreedna.com pdf DNA.RootsiHaplogroupISpread.pdf Phylogeography of Y Chromosome Haplogroup ... relationships for Y chromosome haplogroup I Reappraising its Phylogeography and Prehistory, in Rethinking ... Siiri Rootsi et al., http www.familytreedna.com pdf DNA.RootsiHaplogroupISpread.pdf Phylogeography of Y Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe , American Journal ... more details
Encyclopedia
top
