A hormoneresponseelement HRE is a short sequence of DNA within the Promoter biology promoter of a gene that is able to bind a specific hormone receptor complex and therefore regulate Transcription genetics transcription . ref name web1 Cite web url http users.rcn.com jkimball.ma.ultranet BiologyPages S SteroidREs.html title Steroid Hormone Receptors and their Response Elements accessdate 2006 11 09 ref The sequence is most commonly a pair of inverted repeat s separated by three nucleotides, which also indicates that the receptor binds as a protein dimer dimer . A gene may have many different response elements, allowing complex control to be exerted over the level and rate of transcription. ref name isbn0 7167 4366 3 cite book author Monty Krieger Matthew P Scott Matsudaira, Paul T. Lodish, Harvey F. Darnell, James E. Lawrence Zipursky Kaiser, Chris Arnold Berk title Molecular Cell Biology, Fifth Edition publisher W. H. Freeman location San Francisco year 2003 isbn 0 7167 4366 3 oclc doi page 973 pages ref HRE are used in transgenic animal cells as Inducer biology inducer of gene expression. References Reflist Category Gene expression genetics stub de ResponseElement es Elemento de respuesta a hormonas fr l ment de r ponse biologie mol culaire ... more details
Response elements are short sequences of DNA within a gene promoter region that are able to bind a specific transcription factor and regulate Transcription genetics transcription of gene s. Examples Examples of response elements include Hormoneresponseelement cAMP responseelement External links MeshName responseelement Category DNA Biochemistry stub Transcription ... more details
The HIV 1 Rev responseelement RRE is a highly structured, 350 nucleotide RNA segment present in the Env ... title A Molecular Rheostat Co operative Rev Binding to Stem I of the Rev responseElement Modulates ... pnas.1007022107 title HIV Rev responseelement RRE directs assembly of the Rev homooligomer into discrete ... 1 Rev dimer structure at 3.2 A resolution for multimeric binding to the Rev responseelement year ... of the HIV 1 Rev responseelement alone and in complex with regulator of virion rev studied by atomic ... Rev ResponseElement RNA by Metallopeptide Complexes year 2006 last1 Jin first1 Yan last2 Cowan ... title HIV Rev responseelement RRE directs assembly of the Rev homooligomer into discrete asymmetric ... for multimeric binding to the Rev responseelement year 2010 last1 Dimattia first1 M. A. last2 ... a conformational switch in the HIV 1 Rev responseelement year 2008 last1 Legiewicz first1 M. last2 ... cite journal doi 10.1186 1742 6405 5 11 pmc 2438438 title Substitution of the Rev responseelement ... with the HIV Rev responseelement RNA year 2008 last1 Sugaya first1 Maki last2 Nishino first2 Norikazu ... ResponseElement RNA year 2007 last1 Moehle first1 Kerstin last2 Athanassiou first2 Zafiria ... competent oligonucleotides directed to the HIV 1 Rev responseelement year 2007 last1 Prater first1 ... journal pages 23 9 doi 10.1007 s11262 004 4578 9 title Functional Variability of Rev ResponseElement ... 367 73 doi 10.1002 jmv.20279 title Functional variation of HIV 1 Rev responseelement in a longitudinally ... Dimers and Acridine Conjugates to the HIV 1 Rev ResponseElement year 2003 last1 Luedtke ... title Heterogeneity of HIV 1 Rev ResponseElement year 2003 last1 Phuphuakrat first1 Angsana last2 ... molecule modulators of HIV Rev Rev responseelement interaction identified by random screening ... Analogs of Neomycin B Potential Inhibitors of the HIV RNA Rev ResponseElement year 2000 last1 Nishizono ... Kinetics of HIV 1 Rev Rev ResponseElement Interactions. DEFINITION OF MINIMAL BINDING SITES ON RNA ... more details
File Iron Responsive Element.ogv thumb 200px left A 3D representation of the iron responseelement. This is the IRE in the ferritin mRNA of a frog in complex with the iron responsive element IRE of a rabbit ... 10.1126 science.1133116 pmid 17185597 ref Infobox rfam Name Iron responseelement image RF00037.jpg ... In Molecular biology , the Iron responseelement or Iron responsive element IRE is a short conserved stem loop which is bound by Iron responsive element binding protein iron response proteins IRPs ... responseelement http mrna.otago.ac.nz cgi bin tt data browse RNAMotif?PatID T0102 Transterm page ... Responsive Elements Prediction Server DEFAULTSORT Iron ResponseElement Category Cis regulatory RNA elements molecular cell biology stub de Iron ResponseElement ... Rfam RF00037 miRBase miRBase family RNA type Cis regulatory element Cis reg Tax domain Eukaryota GO ... title Systemic iron homeostasis and the iron responsive element iron regulatory protein IRE IRP ... iron responsive element IRE within crayfish ferritin mRNA and an iron regulatory protein 1 IRP1 ... of the iron responsive element RNA implications for binding of the RNA by iron regulatory binding ... , A. Dancis , J. B. Harford & R. D. Klausner title Identification of the iron responsive element for the translational ... iron responsive element in murine and human erythroid delta aminolevulinic acid synthase mRNA ... dehydrogenase b mRNA of Drosophila melanogaster has a functional iron responsive element in its 5 untranslated ... responsive element like sequence in the mRNA journal The Journal of biological chemistry volume ... , Cinzia Garuti , David J. Haile & Antonello Pietrangelo title The role of the iron responsive element ... element in the 3 UTR of human MRCKalpha journal Biochemical and biophysical research communications ... and the cell cycle identification of an iron responsive element in the 3 untranslated region ... Hypoxia inducible factors and the response to hypoxic stress journal Molecular cell volume 40 issue ... more details
Orphan date January 2010 Woodchuck hepatitis virus Woodchuck Hepatitis Virus WHP Posttranscriptional Regulatory Element WPRE is a DNA sequence that, when transcribed creates a tertiary structure enhancing gene expression expression . Commonly used in molecular biology to increase expression of gene s delivered by viral vector s. ref Optimizing regulatable gene expression using adenoviral vectors. Lee YB, Glover CP, Cosgrave AS, Bienemann A, Uney JB. Exp Physiol. 2005 Jan 90 1 33 7. Epub 12 November 2004. Review. ref The slightly variable sequence is 80bp long GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT ref Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element. Donello JE, Loeb JE, Hope TJ. J.Virol. 1998 Jun 72 6 5085 92 ref References references Category Gene expression Category DNA Genetics stub ... more details
Infobox rfam Name Trans activation responseelement TAR image RF00250.jpg width caption Predicted secondary structure and sequence conservation of mir TAR Symbol mir TAR AltSymbols TAR Rfam RF00250 miRBase miRBase family RNA type Gene MicroRNA miRNA Tax domain Virus es GO GO 0035068 GO 0035195 SO SO 0000233 SO 0001244 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The HIV trans activation response TAR element is an cis regulatory element RNA element which is known to be required for the trans activation of the viral promotor biology promoter and for virus replication. The TAR stem loop hairpin acts as a binding site for the Tat HIV Tat protein and this interaction stimulates the activity of the long terminal repeat promoter. ref cite journal last Kulinski first T coauthors Olejniczak M, Huthoff H, Bielecki L, Pachulska Wieczorek K, Das AT, Berkhout B, Adamiak RW year 2003 title The apical loop of the HIV 1 TAR RNA hairpin is stabilized by a cross loop base pair journal J Biol Chem volume 278 pages 38892 38901 pmid 12882959 doi 10.1074 jbc.M301939200 issue 40 ref Further analysis has shown that TAR is a microRNA pre microRNA that produces mature microRNAs from both strands of the TAR stem loop. ref name pmid18299284 cite journal author Ouellet DL, Plante I, Landry P, et al title Identification of functional microRNAs released through asymmetrical processing of HIV 1 TAR element journal Nucleic Acids Res. volume 36 issue 7 pages 2353 65 year 2008 month April pmid 18299284 pmc 2367715 doi 10.1093 nar gkn076 url http nar.oxfordjournals.org cgi pmidlookup?view long&pmid 18299284 ref These miRNAs are thought to prevent infected cells from ... reflist 1 External links Rfam id RF00250 name Trans activation responseelement TAR http microrna.sanger.ac.uk ... biology stub Category MicroRNA Category Cis regulatory RNA elements de Trans activation responseelement ... more details
in response to a hormonal signal, is the effective concentration of hormone receptor complexes that are formed ... or prohormone s. These can then be quickly converted into their active hormone form in response to a particular ... type hormone A hormone from Greek language Greek lang grc , impetus is a chemical released by a cell .... Only a small amount of hormone is required to alter cell metabolism . In essence, it is a chemical ... transported in the blood. Cells respond to a hormone when they gene expression express a specific receptor biochemistry receptor for that hormone. The hormone binds to the receptor protein , resulting .... endocrine system Endocrine hormone molecule s are secreted released directly into the bloodstream ... modern chemical compounds have hormone like effects on both humans and wildlife. Their Endocrine ... Citation needed date March 2010 Biosynthesis of a particular hormone in a particular tissue Storage and Cellular secretion secretion of the hormone Transport of the hormone to the target cell s Recognition of the hormone by an membrane protein associated cell membrane or intracellular receptor ... transduction process This then leads to a cellular response. The reaction of the target cells may then be recognized by the original hormone producing cells, leading to a down regulation in hormone ... of the hormone. Hormone cells are typically of a specialized cell type, residing within a particular ... with receptors Most hormones initiate a cellular response by initially combining with either a specific .... A cell may have several different receptors that recognize the same hormone and activate different ... hormone s, the receptor is membrane associated and embedded in the plasma membrane at the surface of the cell. The interaction of hormone and receptor typically triggers a cascade of secondary effects ... hormone s also interact with intracellular receptors located in the cytoplasm or Cell nucleus nucleus by an intracrine mechanism. For hormones such as Steroid hormone steroid or Thyroid hormone ... more details
wiktionary Element may refer to Chemistry, electronics, or the geosciences Chemical element , a building block in chemistry Electrical element , an abstract part of a circuit Heating element , a device that generates heat by electrical resistance Orbital elements Weather , sometimes referred to as the elements Computing Adobe Photoshop Elements , a bitmap graphics program Adobe Premiere Elements , a video editing computer program Array data structure elements Data element , a unit of data HTML element , a standard part of a HTML document Law Element criminal law , a basic set of common law principles regarding criminal liability Mathematics Element mathematics , one of the constituents of a set Euclid s Elements Euclid s Elements , a mathematical treatise on geometry and number theory Music Element production team , a Norwegian production and songwriting team Elements Atheist album Elements Atheist album Elements band , 1980s 90s American jazz ensemble Elements Roger Glover album Elements Roger Glover album Elements Steve Howe album Elements Steve Howe album Elements, Pt. 1 , an album by Stratovarius Elements, Pt. 2 , an album by Stratovarius The Elements album The Elements album , a 2007 ... Oldfield, four CD edition Philosophy Bh ta are five elements in Hinduism Classical element s, part ... of the universe according to Chinese Taoism Other Element by Westin , a brand of Starwood Hotels and Resorts Worldwide Element Skateboards , a skateboard manufacturer Elements, Hong Kong , a shopping mall in Hong Kong Honda Element , a sport utility vehicle See also lookfrom intitle Elemental disambiguation ... ar ca Element cs Element cy Elfen de Element et Element es Elemento eo Elemento eu Elementu fa fr l ment fur Element ga D il gv Elmint gl Elemento ko io Elemento id Unsur disambiguasi ... lt Elementas ms Unsur nl Element ja pap Elemento pl Element pt Elementos ro Element ru simple Element sk Element sl Element sh Element fi Elementti sv Element tl Elemento tt ... more details
wiktionarypar response respond rejoinder Response may refer to Response liturgy , a line answering a versicle Response music or antiphon, a response to a psalm or other part of a religious service Output or response, the result of telecommunications input Response, a phase in emergency management The second half of the Stimulus psychology stimulus response relationship in psychology The National War Memorial Canada , also known as The Response . See also Response variable or realization thereof Answer Action disambiguation Transient response Steady state response Stimulus response model in statistics Response rate , to surveys. Also mentions complete response and partial response re oncology. disambig de Response es Respuesta ja zh ... more details
Infobox rfam Name S element image RF00490.jpg width caption Predicted secondary structure and sequence conservation of S element Symbol S element AltSymbols Rfam RF00490 miRBase miRBase family RNA type Cis regulatory element Cis reg Tax domain Bacteria GO SO SO 0000233 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The S element is an cis regulatory element RNA element found in p42d and related plasmid s. The S element has multiple functions and is believed to act as a negative regulator of repC Transcription genetics transcription , and be required for efficient replication and act as a translation al enhancer of repC. ref cite journal last Venkova Canova first T coauthors Soberon NE, Ramirez Romero MA, Cevallos MA year 2004 title Two discrete elements are required for the replication of a repABC plasmid an antisense RNA and a stem loop structure journal Mol Microbiol volume 54 pages 1431&ndash 1444 pmid 15554980 doi 10.1111 j.1365 2958.2004.04366.x issue 5 ref See also ctRNA References reflist 1 External links Rfam id RF00490 name S element Category Cis regulatory RNA elements molecular cell biology stub ... more details
factor cAMP responseelement binding protein CREB . Phosphorylated CREB, together with its ... cAMP responseelement s in the promoter region of the GH gene. It also increases transcription ...Protein Name Growth hormone releasing hormone image caption Symbol GHRH AltSymbols GRF, GHRF HGNCid 4265 Chromosome 20 Arm p Band LocusSupplementaryData 12 or q11.2 q12 ECnumber OMIM 139190 EntrezGene 2691 RefSeq NM 021081 UniProt P01286 PDB Growth hormone releasing hormone GHRH , also known as growth hormone releasing factor GRF , GHRF , somatoliberin or somatocrinin , is a releasing hormone for growth hormone . It is a 44 ref name GeneGlobe amino acid peptide hormone produced in the arcuate nucleus of the hypothalamus . GHRH first appears in the human hypothalamus between 18 and 29 weeks of gestation, which corresponds to the start of production of growth hormone and other somatotropes in fetuses. ref name GeneGlobe Origin GHRH is released from neurosecretory nerve terminals of these arcuate neurons, and is carried by the hypothalamo hypophyseal portal system to the anterior pituitary gland where it stimulates growth hormone GH secretion by stimulating the growth hormone releasing hormone receptor . GHRH is released in a pulsatile manner, stimulating similar pulsatile release of GH. In addition, GHRH also promotes slow wave sleep directly. ref cite journal author Ob l F, Krueger J ... 5 year 2001 pmid 11924022 ref Growth hormone is required for normal postnatal growth, bone growth, regulatory ... pituitary. Receptor Main Growth hormone releasing hormone receptor The GHRHR is a member ... premade growth hormone. ref name GeneGlobe Some Ca sup 2 sup influx is also a direct action ... by somatostatin growth hormone inhibiting hormone . Somatostatin is released from neurosecretory nerve ... bg de Somatoliberin es Somatocrinina fr Hormone de lib ration de l hormone de croissance gl Hormona liberadora da hormona do crecemento hr Somatokrinin id Somatokrinin ... more details
A hormone receptor is a molecule that can bind to a specific hormone . Receptors for peptide hormones tend to be found on the cell membrane plasma membrane of cells, whereas receptors for lipophillicity lipid soluble hormones are usually found within the cytoplasm . Upon hormone binding, the receptor can initiate multiple signaling pathways which ultimately lead to changes in the behaviour of the target cells. Peptide hormone receptors Many hormones are composed of peptides polypeptides , e.g. thyroid stimulating hormone , follicle stimulating hormone , leutinizing hormone and insulin . These molecules are not lipid soluble and therefore cannot molecular diffusion diffuse through cell membranes. Consequently, receptors for peptide hormones are located on the plasma membrane. Peptide hormone receptors are often transmembrane protein s. They are also called G protein coupled receptor s, sensory receptor s or ionotropic receptor s. These receptors generally function via intracellular second messengers , including cyclic AMP cAMP , inositol 1,4,5 trisphosphate Inositol triphosphate IP3 and the Calcium signaling calcium Ca sup 2 sup calmodulin system. Lipid soluble hormone receptors Steroid hormone receptor s and related receptors are generally soluble proteins that function through gene activation. Their response elements are DNA sequences promoters that are bound by the complex of the steroid bound to its receptor. The receptors themselves are zinc finger proteins. ref http users.rcn.com jkimball.ma.ultranet BiologyPages S SteroidREs.html Steroid Hormone Receptors and their Response Elements ref These receptors include those for Glucocorticoid glucocorticoids , estrogen s, androgen s, thyroid hormone T3 , calcitriol the active form of vitamin D , and the retinoid s vitamin A . References reflist Neuropeptide receptors Transcription factors g2 membrane protein stub receptor ... fr R cepteur d hormone it Recettori ormonali sr Hormonski receptor ... more details
Infobox Album See Wikipedia WikiProject Albums Name In Response Type studio Artist This Day Forward Commented out because image was deleted Cover TDF IR.jpg Released June 17, 2003 Recorded Dec 2002 Feb 2003 Genre Post Hardcore Length Label Equal Vision Records Producer Reviews Allmusic Rating 3 5 Allmusic class album id r644881 pure url yes link Last album Kairos EP br 2002 This album In Response br 2003 Next album In Response is the final studio album by Philadelphia post hardcore band This Day Forward . Track listing White Picket Defense System 3 22 Composed by Frangicetto, This Day Forward One and One 4 01 Composed by Frangicetto, This Day Forward The Breath 4 36 Composed by Frangicetto, Shaw, This Day Forward In the Past ... On the Ground 4 13 Composed by Frangicetto, Shaw, This Day Forward Euphio Question 2 18 Composed by Shaw, This Day Forward Fragile Version 4 18 Composed by Frangicetto, This Day Forward The Red Room 2 16 Composed by Shaw, This Day Forward Abandon the Abbreviated World 3 42 Composed by Frangicetto, Shaw, This Day Forward Nouveau 4 18 Composed by Frangicetto, This Day Forward Voice 5 09 Composed by Frangicetto, Shaw, This Day Forward Seven 3 51 Composed by This Day Forward Performed by Vadim Taver Musicians who played on the album Brendan Ekstrom Guitar Colin Frangicetto Drums Gary Shaw Bass Mike Shaw Vocals Vadim Taver Guitar, Wurlitzer, Vocals Category 2003 albums Category This Day Forward albums Category Equal Vision Records albums ... more details
, a primer regulating element for caste juvenile hormone titer in honey bee larvae Apis mellifera ... s, JH formerly called neotenin refers to a group of hormone s, which ensure growth of the larva ... juvenile hormone JH III. To date JH 0, JH I, and JH II have been identified only in the Lepidoptera ... C.C., Henrich V.C., Gilbert L.I. 1989 Juvenile Hormone Bisepoxide Biosynthesis in vitro by the Ring Gland of Drosophila melanogaster A Putative Juvenile Hormone in the Higher Diptera. Proc Natl Acad ... farnesoate , which is juvenile hormone III lacking the epoxide group. ref Laufer, H, Borst, D, Baker ... hormone like compound in a crustacean. Science 235 202 205 ref Methyl farnesoate is believed ... etc. Juvenile hormones in honey bee s There is a complex interaction between JH, the hormone ecdysone ..., G. E. 2001 . Juvenile hormone levels in honey bee Apis mellifera L. foragers foraging ... undeveloped. ref Pearce A.N., Huang Z.Y., Breed M.D. 2001 Juvenile hormone and aggression in honey ... juvenilehormone.html Juvenile Hormone ref Although, JH does not activate foraging .... P., Jassim, O., Fahrbach, S. E. and Robinson, G. E. 2000 . Juvenile hormone paces behavioral development ... www.pnas.org cgi reprint 104 17 7128 Vitellogenin, juvenile hormone, insulin signaling, and queen ... 16 sub H sub 26 sub O sub 2 sub Juvenile hormone 0 found in Lepidoptera Chemical Abstracts Service CAS ... 32 sub O sub 3 sub Juvenile hormone I found in Lepidoptera Chemical Abstracts Service CAS methyl 2E,6E ... sub 3 sub Juvenile hormone II found in Lepidoptera Chemical Abstracts Service CAS methyl 2E,6E 10R,11S ... www.alanwood.net pesticides juvenile 20hormone 20iii.html Juvenile hormone III Chemical Abstracts Service ... sub O sub 3 sub http scienceblogs.com moleculeoftheday 2007 03 juvenile hormone epoxides not.php Juvenile hormone JHB3 found in diptera Chemical Abstracts Service CAS methyl 2E,6E 6S,7S,10R dioxiranyl ... Synthetic analogues of the juvenile hormone are used as an insecticide , preventing the larvae from ... more details
distinguish Release factor A releasing hormone or releasing factor is a hormone whose main purpose is to control the release of another hormone. The main releasing hormones secreted by the hypothalamus are Thyrotropin releasing hormone TRH , Corticotropin releasing hormone CRH , Gonadotropin releasing hormone GnRH , Growth hormone releasing hormone GHRH , Two other factors are also classed as releasing hormones, although they in fact inhibit pituitary hormone release Somatostatin , Dopamine . For example, TRH is released from the hypothalamus in response to low levels of secretion of thyroid stimulating hormone TSH from the pituitary gland . The TSH in turn is under feedback control by the thyroid hormones Thyroxine T4 and Triiodothyronine T3 . When the levels of TSH are too high, they feed back on the brain to shut down the secretion of TRH. Synthetic TRH is also used by physicians as a test of TSH reserve in the pituitary gland as it should stimulate the release of TSH and prolactin from this gland. Releasing hormones are sometimes known as liberins. For example, TRH may be known as thyroliberin. Inhibiting hormones may be known as statins. For example, dopamine which inhibits prolactin release may be called prolactostatin. Mechanism Releasing hormones increase or, in case of inhibitory factors, decrease the intracellular concentration of calcium Ca sup 2 sup , resulting in vesicle fusion of the respective primary hormone. For GnRH, TRH and GHRH the increase in Ca sup 2 sup is achieved by the releasing hormone coupling and activating G protein coupled receptors coupled to the Gq alpha subunit G sub q sub alpha subunit , activating the IP3 DAG pathway to increase Ca sup 2 ... and Medicine in 1977 for their contributions to understanding the peptide hormone production ... 11 Fulltext . DOI 10.1677 joe.1.05883 PMID 15642779. ref See also Hormone Neuroendocrinology References reflist Category Hormones Category Neuroendocrinology ar de Releasing Hormone he ... more details
secretory Vesicle biology vesicles , which can be secreted from the cell by exocytosis in response ... books?id QmNrJgAACAAJ&dq peptide hormone Peptide Hormone Secretion A Practical Approach ... superfluous amino acid residues that were needed to direct Folding chemistry folding of the hormone molecule into its active configuration but have no function once the hormone folds. Specific endopeptidase ... system bloodstream , generating the mature hormone form of the molecule. Mature peptide hormones ... receptor biochemistry receptors on the surface of their target cells. Some peptide protein hormone s angiotensin angiotensin II , basic fibroblast growth factor 2, parathyroid hormone related protein ... pituitary secretes prolactin , which acts on the mammary gland , adrenocorticotrophic hormone ACTH , which acts on the adrenal cortex to regulate the secretion of glucocorticoids , and growth hormone ... hormone , also called vasopressin, and oxytocin . Peptide hormones are produced by many different ... hormone binds to receptors on the surface of the cell, a second messenger appears in the cytoplasm ... reflist Hormones Category Peptide hormones de Proteohormone es Hormona pept dica fr Hormone peptidique ... more details
For the use of hormone antagonists in cancer , see hormonal therapy oncology A Hormone antagonist is a specific type of receptor antagonist which acts upon hormone s. External links MeshName Hormone antagonists Hormone antagonists biochemistry stub Category Hormonal agents Category Receptor antagonists ... more details
Adipokinetic hormone AKH is a short peptide hormone that has been studied in insect s. It is a lipid mobilising hormone and is responsible for regulating fuel transport in the haemolymph , for redirecting energy to other processes as required by the insect. AKH was initially discovered in the desert locust Schistocerca gregaria and is generally associated with aiding flight. ref Kaufmann, C. and M. Brown, Adipokinetic hormones in the African malaria mosquito, Anopheles gambiae Identification and expression of genes for two peptides and a putative receptor. Insect Biochemistry and Molecular Biology, 2006. 36 6 p. 466 481 ref Early observations of locust s showed that despite the fact that lipids are metabolised by flight muscle in order to maintain flight, which would be transported from the haemolymph, there was often still a high concentration of lipids in the haemolymph, implying that an agent may be responsible for activating lipid transport into the haemolymph and this was thought most likely to be hormonal regulation . ref name Chapter Eleven http entomology.unl.edu ent801 xport.html Chapter Eleven Bot generated title ref The hormone itself is part of a larger family, often referred ..., K.E. Morris, H.R., Structure of locust adipokinetic hormone, a neurohormone that regulates lipid ... and RPCH is so significant that injecting insects with RPCH induces an AKH like response and vice ... group in 1976 and the chemical structure was determined to be a peptide hormone formed from 10 amino acids . This was the first instance where an insect peptide hormone had been identified. ref name ... in locusts. ref Goldsworthy, G.J., K. Opoku Ware, and L.M. Mullen, Adipokinetic hormone and the immune ... hormone enhances laminarin and bacterial lipopolysaccharide induced activation of the prophenoloxidase ... to a stronger immune response than locusts which only received an LPS injection. ref name Goldsworthy ... Adipokinetic Hormone Category Insect hormones ... more details
Prothoracicotropic hormone PTTH was the first insect hormone to be discovered. It was originally described simply as brain hormone by early workers such as Stefan Kopec Stefan Kope 1922 ref Cite journal issn 0006 3185, 1939 8697 volume 42 issue 6 pages 323 342 last KOPE first Stefan title Studies on the Necessity of the Brain for the Inception of Insect Metamorphosis journal The Biological Bulletin accessdate 2012 02 26 date 1922 06 01 url http www.biolbull.org content 42 6 323 jstor 1536759 ref and Vincent Wigglesworth 1934 , ref Wigglesworth, V.B. 1934. The physiology of ecdysis in Rhodnius prolixus Hemiptera . II Factors controlling moulting and metamorphosis. Quart. J. Microsc. Sci. 77 191 223. ref who realized that ligation of the head of immature insects could prevent molting or pupation of the body region excluded from the head if the ligation was performed before a critical age in the lifestage was reached. After a certain point the ligation had no effect and both sections of the insect would molt or pupate. However, implantation of a conspecific brain to a Sessility zoology sessile ligated abdomen or an abdomen under diapause ref Cite journal doi 10.2307 1538279 issn 0006 3185 volume 93 issue 2 pages 89 98 last Williams first Carroll M. title Physiology of Insect Diapause. II. Interaction between the Pupal Brain and Prothoracic Glands in the Metamorphosis of the Giant ... to be the source of the hormone that induces molting in insects. Later it was established that the insect brain produces a number of hormones, but the hormone which was the cause of the observations made by Kope and Wigglesworth was prothoracicotropic hormone . PTTH is secreted by a neurohemal ... structure posterior to the brain. PTTH is released in response to environmental stimuli and as its name implies PTTH acts on the prothoracic gland s, which respond by releasing molting hormone an ecdysteroid into the haemolymph . Molting hormone stimulates the molting process ref Chapman, R.F. ... more details
Hormone may refer to Hormone , a chemical that sends messages in a plant or animal Hormone , the NATO reporting name for the Soviet Russian Kamov Ka 25 military helicopter Hormones 2008 film Hormones , a 2008 Thai film disambig ... more details
s in the anterior pituitary anterior lobe or adenohypophysis of the pituitary gland in response to the hormone corticotropin releasing hormone CRH released by the hypothalamus . ref cite web title Adrenocorticotropic Hormone ACTH url http www.vivo.colostate.edu hbooks pathphys endocrine hypopit acth.html ...protein Name proopiomelanocortin adrenocorticotropin beta lipotropin alpha melanocyte stimulating hormone beta melanocyte stimulating hormone beta endorphin caption POMC image width HGNCid 9201 Symbol POMC AltSymbols EntrezGene 5443 OMIM 176830 RefSeq NM 000939 UniProt P01189 PDB ECnumber Chromosome 2 Arm p Band 23 LocusSupplementaryData Adrenocorticotropic hormone ACTH , also known as corticotropin , is a Peptide polypeptide tropic hormone produced and secreted by the Anterior pituitary anterior pituitary gland . It is an important component of the hypothalamic pituitary adrenal axis and is often produced in response to biological stress along with corticotropin releasing hormone from the hypothalamus . Its principal effects are increased production and release of corticosteroids and, as its name suggests, cortisol from the adrenal cortex . A deficiency of ACTH is a cause of secondary adrenal insufficiency and an excess of it is a cause of Cushing s syndrome . Production and regulation ACTH is synthesized from pre pro opiomelanocortin pre POMC . The removal of the signal peptide during ... Hormone, or ACTH , Melanotropin Alpha Melanocyte Stimulating Hormone, or MSH , Corticotropin like ... 13 of which counting from the N terminus may be cleaved to form melanocyte stimulating hormone ... s disease. After a short period of time, ACTH is cleaved into melanocyte stimulating hormone ... thumb center 800px Reference ranges for blood tests , showing adrenocorticotropic hormone ... Neuropeptidergics DEFAULTSORT Adrenocorticotropic Hormone Category Anterior pituitary hormones ... es Hormona adrenocorticotropa eu Hormona adrenokortikotropiko fr Hormone corticotrope ... more details
are produced in the testicle testes while women s are produced in the ovary ovaries . If hormone ... treatment of a growth hormone. It is possible that the imbalance could also cause an overproduction ... 6,000 endocrine system endocrine disorders that result because of hormone imbalance .... The primary hormone that causes these changes is estrogen . Estrogen and progesterone A hormonal ... within a woman s body. Estrogen is naturally produced by the ovaries and is the female hormone necessary ... their production of estrogen and progesterone, causing symptoms of hormone imbalance to develop. Estrogen replacement therapy is a common treatment for hormone imbalance. Frequently, only estrogen ... cancer. Causes There are multiple causes for hormone imbalance, but the majority of cases are experienced ... lifestyle . Of all of these causes, obesity is the number one medical cause for hormone imbalance ... experienced during hormone imbalance are shared by male and female, while some are more specific .... If the reactions become more severe then we run into actual hormone allergy where we find a group of more serious disorders. ref http www.onlineallergycenter.com treatments hormone imbalance.htm Hormonal ..., broken sleep patterns or insomnia, and changes in sexual response. There is no need for prevention ... levels are recommended. Treatment for hormone imbalance It is important to understand all the risks and benefits of hormone replacement therapy HRT . Patients with a history of active or past breast ... the risk of heart disease as well. Improper use of hormones A dangerous or fatal hormone imbalance ..., use of these hormones can result in a hormone imbalance that causes an increase in aggressive ... more details
Unreferenced date December 2009 Hormone therapy or hormonal therapy is the use of hormones in medical treatment. Treatment with hormone antagonist s may also referred to as hormonal therapy . Wikipedia has the following articles regarding this topic Cancer Hormonal therapy oncology Hormonal therapy for cancer . Hormone therapy for prostate cancer refers to androgen deprivation therapy . Aging Hormone replacement therapy menopause connected to menopause Testosterone replacement in males with low levels due to disease or aging Sex reassignment Hormone replacement therapy female to male in sex reassignment therapy for trans men Hormone replacement therapy male to female in sex reassignment therapy for trans women Intersex conditions Hormone therapy in Klinefelter s syndrome Hormone therapy in Turner syndrome Hormonal deficiency Growth hormone treatment for growth hormone deficiency Thyroid hormone replacement in hypothyroidism Psychological treatment Chemical castration of violent sex offender s See also Growth Hormone treatment Life extension Androgenics Estrogenics Progestogenics DEFAULTSORT Hormone Therapy Category Medical treatments Treatment stub systemic hormonal drug stub de Hormontherapie fr Hormonoth rapie it Terapia ormonale he nl Hormoonbehandeling ja pl Hormonoterapia pt Terapia hormonal fi Hormonihoito ... more details
hormones , thyroxine T sub 4 sub and triiodothyronine T sub 3 sub , are tyrosine based hormone ... the disease known as goitre . The major form of thyroid hormone in the blood is thyroxine T sub ... T sub 0 sub a . Circulation and transport Plasma transport Most of the thyroid hormone ... hormone is free unbound and biologically active, hence measuring concentrations of free thyroid hormones is of great diagnostic value. When thyroid hormone is bound, it is not active, so the amount ... of the cell, the thyroid hormone receptor s. T sub 1 sub a and T sub 0 sub a are positively charged ... diagnostic tool is measurement of the amount of thyroid stimulating hormone TSH that is present. Membrane ... bone growth synergy with growth hormone and neuronal maturation, and increase the body s sensitivity ... stimuli influence thyroid hormone synthesis. Thyroid hormone leads to heat generation ... is the free thyroxine index , which is total thyroxine multiplied by thyroid hormone uptake , which ... 3 sub and T sub 4 sub are used to treat thyroid hormone deficiency hypothyroidism . They are both ... most patients are treated with levothyroxine, or a similar synthetic thyroid hormone. ref name Robert ... levothyroxine sodium article.htm preferred thyroid hormone Levothyroxine Sodium Synthroid ..., Desiccated thyroid extract natural thyroid hormone supplements from the dried thyroids of animals are still ... less popular, due to evidence that varying hormone concentrations in the thyroids of animals before ... assn.org content 291 12 1445.2.full ref ref cite journal last Cooper first DS title Thyroid hormone ... to T3. ref http www.ncbi.nlm.nih.gov pubmed 11786691 Thyroid hormone replacement therapy ref These patients may choose to take natural thyroid hormone as it contains a mixture of T4 and T3, ref name .... Some natural thyroid hormone brands are F.D.A. approved, but some are not. ref name usdoctor thyroid ... with a low functioning thyroid will also need to increase her dosage of thyroid hormone. ref name ... more details
al. title Serum proteome profiles identifies parathyroid hormone physiologic response journal Proteomics ... TJ title Does bone resorption inhibition affect the anabolic response to parathyroid hormone? journal ...PBB geneid 5741 Parathyroid hormone PTH , parathormone or parathyrin , is secreted by the Parathyroid ... to increase the concentration of calcium Ca sup 2 sup in the blood , whereas calcitonin a hormone ... hormone 1 receptor high levels in bone and kidney and the parathyroid hormone 2 receptor high levels ... C, Prager G, Niederle B title Kinetic analyses of parathyroid hormone clearance as measured by three ..., Schevitz RW, Smiley DL, Tashjian AH, Zhang F title Crystal structure of human parathyroid hormone ... hormone PTH has been crystallized and the structure has been refined to 0.9 resolution ... http pymol.sourceforge.net PyMOL . ref Function Regulation of serum calcium Parathyroid hormone regulates ... contained in the bones. ref cite journal author Poole K, Reeve J title Parathyroid hormone a bone ... 2003 pages 1300 isbn 1 4160 2328 3 oclc doi ref The role of parathyroid hormone is shown in blue. PTH ... pathway map VitaminDSynthesis WP1531 highlight Parathyroid hormone Regulation of PTH secretion Secretion of parathyroid hormone is controlled chiefly by blood plasma serum Ca sup 2 sup through feedback ... the parathyroid glands in response to reduced serum calcium levels. PTH acts on the proximal tubules ... PTH level is 10 60 pg ml. See also Parathyroid hormone family Calcium metabolism Disorders of calcium metabolism Parathyroid hormone related protein References Reflist 2 Further reading refbegin ... protein products, parathyroid hormone and vascular calcification in uremia journal Blood Purif. volume ... AM title Parathyroid hormone and periosteal bone expansion journal J. Bone Miner. Res. volume 17 issue ... sequence of human parathyroid hormone journal Biochemistry volume 17 issue 26 pages 5723 9 year 1979 ... JT title A reinvestigation of the amino terminal sequence of human parathyroid hormone journal Biochemistry ... more details
Encyclopedia
top
