to Guanine G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M405 See also Singlenucleotide polymorphism Unique event polymorphism Human Y chromosome DNA haplogroup s List of Y STR markers External links http hpgl.stanford.edu publications AHG 2001 218 Y markers.doc Sequence information for 218 M series markers published by 2001 http www.isogg.org tree ISOGG YDNA SNP Index07.html ISOGG YDNA ...class wikitable Mutation number Nucleotide change Position base pair Total size base pair s Position Forward 5 3 Reverse 5 3 M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc M3 M4 M8 M9 M15 M17 M20 M33 M35 M38 M40 M42 M45 M52 M55 M57 M60 M64.1 M75 M89 M91 M94 M95 M96 M105 M122 M124 M130 M131 M132 M139 M145 M168 M170 M172 M173 M174 M175 M176 M179 M201 M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg M241 Guanine G to Adenine A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M242 Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt M258 M267 Thymine T to Guanine G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M268 M269 M285 Guanine G to Cytosine C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M286 Guanine G to Adenine A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M287 Adenine A to Thymine T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M297 M299 M304 Adenine A to Cytosine C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt M306 M335 Thymine T to Adenine A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta M339 Thymine T to Guanine G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt M340 Guanine G to Cytosine C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa M342 Cytosine C to Thymine T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact ... Data Category DNA Category Human evolution Category Population genetics Category Genetic genealogy ... more details
Image dna SNP.svg thumb DNA molecule 1 differs from DNA molecule 2 at a single base pair location a C T polymorphism . Multiple issues refimprove March 2011 primarysources March 2011 A singlenucleotide polymorphism SNP , pronounced snip is a DNA sequence variation occurring when a singlenucleotide ... allele frequencies for singlenucleotidepolymorphisms. There are variations between human populations ... region Synonymous Nonsynonymous Missense Nonsense Singlenucleotide polymorphism biology polymorphisms ... first2 S.N. title Identification of base pairs in singlenucleotidepolymorphisms by MutS protein ... analysis of singlenucleotidepolymorphisms ternary encoding of genotypes. journal Analytical chemistry ..., two sequenced DNA fragments from different individuals, AAGC C TA to AAGC T TA, contain a difference in a singlenucleotide. In this case we say that there are two allele s C and T. Almost all common ... first9 Beverley J. title A map of human genome sequence variation containing 1.42 million singlenucleotidepolymorphisms journal Nature volume 409 issue 6822 pages 928 33 year 2001 pmid 11237013 ... base nucleotide substitutions and short deletion and insertion polymorphisms http www.hgmd.cf.ac.uk ... Online tool that identifies polymorphisms in test DNA sequences. http www.informatics.jax.org ... Nucleotide Polymorphism Category Molecular biology Category Population genetics Category DNA Category ... de SingleNucleotide Polymorphism et ksiku nukleotiidi pol morfism es Polimorfismo ... of SNPs in the human genome Microsatellites as predictors of nucleotide diversity and divergence ... are exploited in DNA profiling DNA fingerprinting , which is used in forensic science. Also, these genetic ... of genetic variations. For example, a single base difference in the Apolipoprotein E is associated with a higher ... polymorphisms. ref cite journal last Stenson first PD coauthors Mort, M, Ball, EV, Howells, K ... Variations in the DNA sequences of humans can affect how humans develop disease s and respond to pathogen ... more details
DNA , the two Singlenucleotide polymorphism SNP s defining this haplogroup unite I, J, and K within ... Haplogroup F YDNA Haplogroup F descendants Haplogroup IJ YDNA IJ , Haplogroup K YDNA K mutations ... DNA haplogroups human Y chromosome DNA haplogroup . Haplogroup IJK is a descendant branch of the macrohaplogroup Haplogroup F YDNA F with Haplogroup IJ YDNA haplogroup IJ and Haplogroup K YDNA ... SL, Hammer MF title New binary polymorphisms reshape and increase resolution of the human Y chromosomal ... published research. IJK IJK L15 S137, L16 S138, L69.1 G S163.1 Haplogroup IJ YDNA IJ M429 P125, P123, P124, P126, P127, P129, P130, S2, S22 Haplogroup K YDNA K M9, P128, P131, P132 Some of the main ... Clade 1 Haplogroup IJ label1 Haplogroup IJ YDNA Haplogroup IJ 1 Clade 1 Haplogroup I label1 Haplogroup I YDNA Haplogroup I 1 Clade 1 Haplogroup I1. Northern Europe . 2 Haplogroup I2. Scattered around Europe 2 Haplogroup J label2 Haplogroup J YDNA Haplogroup J 2 Clade 1 Haplogroup J1 YDNA Haplogroup J1 . Middle East . 2 Haplogroup J2 YDNA Haplogroup J2 . Middle East . 2 Haplogroup K label2 Haplogroup K YDNA Haplogroup K 2 Clade 1 Haplogroup L YDNA Haplogroup L . South Asia . label2 Haplogroup MNOPS YDNA Macro haplogroup MNOPS 2 Haplogroup MNOPS 2 Clade 1 Haplogroup M YDNA Haplogroup M . New Guinea , Indonesia , Melanesia and Polynesia . label2 Haplogroup NO YDNA Macro haplogroup NO 2 Clade 1 Haplogroup N YDNA Haplogroup N . Mainly found in Northern Asia , Northern Europe , and Eastern Europe . 2 Haplogroup O YDNA Haplogroup O . Mainly found in East Asia , Southeast Asia , and Oceania . label3 Haplogroup P YDNA Macro haplogroup P 3 Clade 1 Haplogroup Q YDNA Haplogroup Q . Mainly found in Northern Asia and the Americas . label2 Haplogroup R YDNA Macro haplogroup R 2 Clade 1 Haplogroup R1 YDNA Macro haplogroup R1 . Europe , parts of Central Asia , South Asia , West Asia , and in parts of Africa such as Cameroon . 2 Haplogroup R2 YDNA Haplogroup R2 . Mainly found in South ... more details
such as singlenucleotidepolymorphisms, or SNPs. These SNPs mark the branch of a haplogroup, and indicate that all descendents of that haplogroup at one time shared a common ancestor. The YDNA SNP ... mutations M3 rs3894 members In human genetics , Haplogroup Q1a3a1 YDNA small phylogenetic name small and or Q M3 small mutational name small is a Human Y chromosome DNA haplogroup Y chromosome DNA haplogroup YDNA . ref name Genebase cite web title Learn about YDNA Haplogroup Q work Wendy Tymchuk ... to 20,000 years before present ref Haplogroup Q1a3a1 is a subclade of Haplogroup Q YDNA Haplogroup ... history of indigenous peoples of the Americas YDNA haplogroups in Indigenous peoples of the Americas Haplogroup Q1a3a1 is one of the few Y Chromosome haplogroup strictly associated with the indigenous peoples of the Americas, along with haplogroup Haplogroup C3 YDNA C3b P39 which is almost exclusively found in North America. This haplogroup is defined by the presence of the rs3894 M3 singlenucleotide polymorphism SNP . The M3 SNP is found downstream from the M242 SNP. M242 is the defining ... American populations ref name subclades See also Human Y chromosome DNA haplogroup Haplogroup Q YDNA Haplogroup Q Haplogroup Q1a3 YDNA Haplogroup Q1a3 YDNA References references External links http www.familytreedna.com public Amerind 20Y The YDNA Haplogroup Q1a3a American Indian Project http www.qydna.org The YDNA Haplogroup Q Project http www.genebase.com learning article 16 Learn about YDNA Haplogroup Q DEFAULTSORT Haplogroup Q1a3a1 YDna Category Human YDNA haplogroups Q1a3a ca Haplogrup Q3 del cromosoma Y hum ... subclade. Haplogroup Q, possibly the youngest of the 20 Y chromosome haplogroups, originated with the SNP ... ref name demographic 2003 http www.ucl.ac.uk tcga tcgapdf Bortolini AJHG 03 YAmer.pdf Y Chromosome ... more details
father to son male line s. Men within this haplogroup have Y chromosome s with the singlenucleotide ... Sforza ref ancestor Haplogroup BT YDNA BT descendants Haplogroup CF YDNA CF and Haplogroup DE YDNA DE mutations P9.1, M168, M294, V9, V41, V54, V189, and V226 In human genetics , Haplogroup CT ... human male lines except haplogroup A YDNA A and haplogroup B YDNA B , which are both found almost ... Cite journal title Use of Y Chromosome and Mitochondrial DNA Population Structure in Tracing ... of CT are in one of two major sub clades, Haplogroup CF YDNA CF and Haplogroup DE YDNA DE .... Citation needed date September 2010 In turn, DE is divided into an Asian haplogroup D YDNA haplogroup D and a predominantly Africa distributed haplogroup E YDNA haplogroup E , while CF is divided into an East Asian, American, and Oceanian haplogroup C YDNA haplogroup C and haplogroup F YDNA ... Haplogroup CF YDNA Haplogroup CF P143 Haplogroup C YDNA Haplogroup C M130, M216 Found in Asia , Oceania , and North America Haplogroup C1 YDNA Haplogroup C1 M8, M105, M131 Found in Japan Haplogroup C2 YDNA Haplogroup C2 M38 Found in Indonesia , New Guinea , Melanesia , Micronesia , and Polynesia Haplogroup C3 YDNA Haplogroup C3 M217, P44 Found throughout Eurasia and North America, but especially ... speaking peoples Haplogroup C4 YDNA Haplogroup C4 M347 Found in the indigenous Australians indigenous peoples of Australia Haplogroup C5 YDNA Haplogroup C5 M356 Found in South Asia , Central Asia , and Southwest Asia Haplogroup F YDNA Haplogroup F M89, M213 Found throughout Eurasia , Oceania , and Americas the Americas F1 P91, P104 F2 M427, M428 F3 P96 F4 P254 Haplogroup G YDNA M201, P257 Found in Europe , Western Asia , Central Asia , South Asia , and North Africa Haplogroup H YDNA M69, M370 ... Asia , North Africa and East Africa Haplogroup I YDNA M170, M258, P19, P38, P212, U179 Found in Europe Haplogroup J YDNA 12f2.1, M304 Found in Europe , Western Asia , North Africa and East Africa ... more details
Infobox haplogroup name Q1a3 map origin date origin place Eurasia ancestor Q1a descendants Q1a3a, Q1a3b mutations L56, L57, M346 members Haplogroup Q1a3 is a subclade of Y DNA Haplogroup Q Y DNA Haplogroup Q . Haplogroup Q1a3 is defined by the presence of the M346 Single Nucleotide Polymorphism SNP and may therefore be referred to as Q M346 in shorthand . Distribution Q1a3 was first thought to be isolated to India ref A novel subgroup Q5 of human Y chromosomal haplogroup Q in India http www.ncbi.nlm.nih.gov pmc articles PMC2258157 . ref but has since been detected in the Middle East, ref Saudi Arabian Y Chromosome diversity and its relationship with nearby regions http www.biomedcentral.com 1471 2156 10 59 ref Europe Citation needed date September 2011 and the Americas. ref Restricted geographic distribution for Y Q paragroup in South America http www3.interscience.wiley.com journal 122506765 abstract. ref Associated SNP s Q1a3 is marked by the presence of the M346 SNP. Since the discovery of M346 several additional SNP s have been found to also be associated with Q1a3. These SNP s include L56 and L57. These SNP s appear to be parallel to M346. ref Family Tree DNA Draft Haplogroup Q Tree http ytree.ftdna.com index.php?name Draft&parent 31182976. ref Subgroups The International Society of Genetic Genealogy ISOGG defines the subgroups of Q1a3 as the following ref ISOGG 2010 Haplogroup Q Tree http www.isogg.org tree ISOGG HapgrpQ.html ref Haplogroup Q1a3a L53, L54, L55 Haplogroup Q1a3a1 Y DNA Haplogroup Q1a3a1 M3 Haplogroup Q1a3a1a M19 Haplogroup Q1a3a1b M194 Haplogroup Q1a3a1c M199, P106, P292 Haplogroup Q1a3b M323 See also Human Y chromosome DNA haplogroup Haplogroup Q Y DNA Haplogroup Q Haplogroup Q1a3a1 Y DNA Haplogroup Q1a3a1 Y DNA References references External links http www.familytreedna.com public yDNA Q The Y DNA Haplogroup Q Project DEFAULTSORT Haplogroup Q1a3 Y Dna Category Human Y DNA haplogroups Q1a3 ... more details
Haplogroup R YDNA R descendants R2 and Haplogroup R2a YDNA R2a mutations M479 members n a Haplogroup R2 is a Human Y chromosome DNA haplogroups Y chromosome haplogroup characterized by genetic marker M479. Term history The first reference to the newly discovered Singlenucleotide polymorphism SNP ... now defines Haplogroup R2a YDNA Haplogroup R2a . The 2010 Y Chromosome Phylogenetic Tree was updated ... YDNA Haplogroup R and its Subclades 2010 . ref Note Before the discovery of the M479 SNP, the M124 ... Paragroup R2 1 label2 Haplogroup R2a YDNA Haplogroup R2a 2 Paragroup R2 ... center 0.071 center Haplogroup R2a Haplogroup R2a YDNA Haplogroup R2a is a Human Y chromosome DNA haplogroups Y chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly ... Haplogroup R2 is a subgroup of Haplogroup R YDNA Haplogroup R M207 R M207 R R1 M306 R2 M479 R2 R2a M124, P249, P267, L266, PAGES00004, L381 R2a R2a1 L295 R2a2 L263 YDNA Description of the M479 SNP ...?card my066 Spread of R2 http www.familytreedna.com public india The India Genealogical DNA Project http www.familytreedna.com public R2 R2 Y Chromosome Haplogroup DNA Project http www.r2dna.org Digging into Haplogroup R2 YDNA http www.familytreedna.com public R2 M124 WTY R2 M124 WTY Walk Through the Y Project http www.familytreedna.com public R Arabia R Arabia YDNA Project http sites.google.com site r2dnainfo R2 Home r2 dna r2 frequency r2 frequencies worldwide?pli 1 List of R2 frequency DEFAULTSORT Haplogroup R2 YDna Category Human YDNA haplogroups R2 ca Haplogrup R2 del cromosoma Y hum ... vaop ncurrent abs ejhg2010146a.html A major Y chromosome haplogroup R1b Holocene era founder effect ... by an asterisk placed after the main haplogroup. Y chromosomes which are positive to the M479 SNP ... efefef Nucleotide change C to T scope row style background efefef Amplicon size bp reference sequence ... scope row style background efefef Y position 19294055 scope row style background efefef Primer forward ... more details
DNA NO descendants O , haplogroup O1 YDNA O1 , haplogroup O2 YDNA O2 , haplogroup O3 YDNA O3 ... DNA haplogroup Y chromosome DNA haplogroup . Haplogroup O is a close cladistic brother group with Haplogroup N YDNA Haplogroup N , and is one of several descendants of haplogroup K YDNA Haplogroup K the intermediates being haplogroup K xLT YDNA Haplogroup K xLT and haplogroup NO YDNA Haplogroup NO . Origins Haplogroup O is a descendant haplogroup of haplogroup NO YDNA Haplogroup NO M214 , and first ... or East Asia . ref name ISOGG http www.isogg.org tree ISOGG HapgrpO.html YDNA Haplogroup O and its ... tree of human Y chromosomes with haplogroup N YDNA Haplogroup N , which is common throughout North ... Asia , and Oceania . Among the subbranches of Haplogroup O are Haplogroup O1 YDNA Haplogroup O1 , Haplogroup O2 YDNA Haplogroup O2 , and Haplogroup O3 YDNA Haplogroup O3 . Paragroup O Haplogroup ... O2b YDNA Haplogroup O2b , which has been found in approximately 30 of many samples of Koreans ... O2 xO2a M95,O2b M176 , or Haplogroup O2b M176. Haplogroup O1 MSY2.2 main Haplogroup O1 YDNA Haplogroup ... O2 M268 main Haplogroup O2 YDNA Haplogroup O2a YDNA Haplogroup O2a M95 Found frequently among ... O2b YDNA Haplogroup O2b M176 Found frequently among Koreans , with a moderate distribution among Buryats ... Thais , and Vietnam ese. Haplogroup O3 M122 main Haplogroup O3 YDNA Found frequently among ... tree of language families and their corresponding Singlenucleotide polymorphism SNP markers, or haplogroup ... O M175 1 clade label1 Northern Asiatic Haplogroup O3 YDNA O3 M122 1 clade label1 Sino Tibetan languages Sino Tibetan Haplogroup O3 YDNA O3a3c M134 1 clade 1 Sinitic languages Sinitic Haplogroup O3 YDNA O3a3c1 M117 2 Tibeto ... O3 YDNA O3a3b M7 2 clade 1 clade 1 Hmong language Hmong Miao 2 She language ... 2 clade 1 clade label1 Austro Asiatic languages Austro Asiatic Haplogroup O2a YDNA O2a ... more details
archiver.rootsweb.com th index YDNA HAPLOGROUP I YDNA HAPLOGROUP I Archives http lists.rootsweb.com index other DNAYDNA HAPLOGROUP I.html YDNA HAPLOGROUP I Mailing List at Rootsweb.com Projects ... ancestor Haplogroup IJ YDNA IJ descendants Haplogroup I1 YDNA I1 , Haplogroup I2 YDNA I2 mutations ... 1 is a Human Y chromosome DNA haplogroup Y chromosome DNA haplogroup , a subgroup of haplogroup IJ YDNA haplogroup IJ , itself a derivative of Haplogroup IJK YDNA Haplogroup IJK . YDNA ... DNA and Y Chromosome Variation in the Caucasus url journal Annals of Human Genetics volume 68 issue ... the Story of Genetic Outliers Told by Mitochondrial DNA and Y Chromosomes url journal American ... I Middle East, Caucasus, Europe. Haplogroup I1 YDNA I1 M253 L64, L75, L80, L81, L118, L121 S62, L123 ... see Haplogroup I2 YDNA Haplogroup I2 Note that the naming of some of the subgroups has changed, as new .... Main Haplogroup I1 YDNA Image with unknown copyright status removed Image I1aHAPLOGROUP.jpg ... French and Italian populations. I M438 Main Haplogroup I2 YDNA Image HaplogroupI2.png thumb ... is supported by recent genetic studies regarding YDNA Haplogroup I2b2 L38 have concluded ... Human Y chromosome DNA haplogroups Haplogroup I1 YDNA Haplogroup I2 YDNA References reflist 2 Notes ... YDNA Haplogroup I and its Subclades refend External links Phylogenetic tree and distribution maps http www.isogg.org tree ISOGG HapgrpI08.html YDNA Haplogroup I and Its Subclades from the International ... Frequency Distributions of YDNA Haplogroup I and its subclades with Video Tutorial http mbe.oxfordjournals.org ... National Geographic magazine National Geographic Lichtenstein Cave DNA Tests I2b2 YDNA found in Bronze ... I2b2 In Search of the Origin of I L38 aka I2b2 YDNA DEFAULTSORT Haplogroup I YDna Category Human YDNA haplogroups I ca Haplogrup I del cromosoma Y hum de Haplogruppe I YDNA es Haplogrupo I ADN Y fr Haplogroupe I hi it Aplogruppo I YDNA ru I Y ... more details
YDNA are M253, M307, P30, and P40. These are known as singlenucleotidepolymorphismsSinglenucleotide polymorphism SNPs . It is a subclade of Haplogroup I YDNA Haplogroup I . Before a reclassification ... YDNA HAPLOGROUP I 2007 12 1198467954 RootsWeb Discussion on YDNA HAPLOGROUP I Mailing List ref Other ... list at RootsWeb. ref http archiver.rootsweb.com th read ydna haplogroup i 2007 01 1168077369 ... I.html Mailing List for YDNA Haplogroup I http isogg.org tree ISOGG HapgrpI07.html Haplogroup ... Haplogroup I YDNA I descendants mutations M253, M307, P30, P40 members People of Northern Europe ... New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree ... archiver.rootsweb.ancestry.com th read YDNA HAPLOGROUP I 2008 04 1209430337 Clade I Information ... its Phylogeography and Prehistory ref ref http archiver.rootsweb.com th read YDNA HAPLOGROUP ... Germanic demographics I1 is overshadowed by the more prevalent Haplogroup R YDNA Haplogroup ... europe european ydna haplogroups.shtml ref When SNPs are unknown or untested and when short ... that, at least for I1, ref http archiver.rootsweb.com th read ydna haplogroup i 2007 04 1176386234 ... YDNA Haplogroup I and its Subclades 2008 ref formerly I1a I1 I1a M21 M253 I1b M227 P37.2 I1b I1b1 ... of the Haplogroup I YDNA Haplogroup I chromosomes are I1. It is common near the southern Baltic ... and Shetland Islands, near 40 percent. Mitochondrial DNA as well as YDNA of northern Germanic ... Germanic names such as Charles de Gaulle , though his family Y chromosome DNA has not been tested. The name ... europe european ydna haplogroups.shtml ref Portugal and Spain The presence of I1 is attested ... european ydna haplogroups.shtml ref Image Varangian routes.png thumb right 300px Map showing the major ... have identified two major lines within Rurikids , Haplogroup N YDNA N1c1a and R1a , ref http ... of the Vikings and the Normans. There can also be other explanations for I1 YDNA s in Turkey ... more details
years BP origin place Asia ref name Karafet ancestor Haplogroup DE YDNA DE descendants Haplogroup D1 YDNA D1 , D2, D3 mutations M174, IMS JST021355, PAGES00003 members In human genetics , Haplogroup D M174 is a Y chromosome haplogroup . Both D and E lineages also exhibit the singlenucleotide polymorphism Haplogroup CT YDNA M168 which is present in all Y chromosome haplogroups except haplogroup A YDNA A and haplogroup B YDNA B , as well as the YAP unique event polymorphism , which is unique ... YDNA haplogroup E contains the distinctive YAP genetics YAP polymorphism which indicates their common ... Overview Like haplogroup C YDNA haplogroup C , D is believed to represent the Great Coastal Migration ... exclusively Haplogroup D chromosomes, although haplogroup C3 YDNA Haplogroup C3 chromosomes also ... HapgrpD.html YDNA Haplogroup D and its Subclades 2010 ref Haplogroup DE YDNA DE D M174, IMS JST021355 ... M174 YDNA in one Southern Altaian individual from Beshpeltir 1 43 2.3 . ref name Kharkov2007 V. N ... also Haplogroup DE YDNA Haplogroup E YDNAYDNA References cite journal author Underhill PA, Kivisild T title Use of y chromosome and mitochondrial DNA population structure in tracing human migrations ... National Geographic Category Human YDNA haplogroups D ca Haplogrup D del cromosoma Y hum de Haplogruppe D YDNA es Haplogrupo D ADN Y fr Haplogroupe D Y ADN hi ru D ... before present. ref name Shi2008 cite journal author Shi H, Zhong H, Peng Y, et al. title Y chromosome ... Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF title New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree journal Genome Research ... in each of the populations that contains a large percentage of individuals whose Y chromosomes belong to Haplogroup D Haplogroup D1 YDNA Haplogroup D1 among the Tibetan people Tibetans as well as among the mainland East Asian populations that display very low frequencies of Haplogroup D Y chromosomes ... more details
al. ref name DhLaFuInIn1987 Multicopy single stranded DNA msDNA is a type of extrachromosomal satellite DNA that consists of a single stranded DNA molecule covalently linked via a 2 5 phosphodiester bond to an internal guanosine of an RNA molecule. The resultant DNA RNA chimera possesses two stem loop ... single stranded DNA isolated from a gram negative bacterium, Myxococcus xanthus journal Cell volume ... Multicopy Single Stranded DNA Strain Present in Yersinia frederiksenii ATCC 33641 Contig01029 Enteropathogenic ... related Myxococcus xanthus. The hypervariable domain in the DNA sequence is shaded gray. The highly ... and structure of stable branched RNA covalently linked to the 5 end of multicopy single stranded DNA of Stigmatella aurantiaca journal Cell volume 48 issue 1 pages 55 62 year 1987 month January ... T, Hosen S, Arifuzzaman M title Comparative Study of different msDNA multicopy single stranded DNA structures and phylogenetic comparison of reverse transcriptases RTs evidence for vertical ... archaebacteria . After a DNA fragment coding for the production of msDNA in E. coli was discovered, ref cite journal author Hsu MY, Inouye M, Inouye S title Retron for the 67 base multicopy single stranded DNA from Escherichia coli a potential transposable element encoding both reverse transcriptase ... left Biosynthesis of msDNA is purported to follow a unique pathway found nowhere else in DNA ... T, Kawanishi H, Tsuchiya T, Inouye S, Inouye M title In Vitro Synthesis of Multicopy Single Stranded DNA, Using Separate Primer and Template RNAs, by Escherichia coli Reverse Transcriptase journal ... to our understanding of DNA synthesis. DNA polymerase s which include RT share highly conserved ..., or even between DNA polymerases using DNA as a template, versus DNA polymerases using RNA as a template ... stranded DNA at 3.0 A resolution shows bent DNA journal Proc. Nat. Acad. Sci. USA volume 90 ... in complex with a polypurine tract RNA DNA journal The EMBO Journal volume 20 pages 1449 61 ... more details
Infobox haplogroup name IJ map Haplogroup IJ YDNA .jpg origin date 35,000 40,000 years BP Citation needed date August 2011 origin place Southwest Asia ancestor Haplogroup IJK YDNA IJK descendants Haplogroup I YDNA I , Haplogroup J YDNA J mutations M429 P125, P123, P124, P126, P127, P129, P130, S2, S22 In human genetics , Haplogroup IJ is a Human Y chromosome DNA haplogroups human Y chromosome DNA haplogroup . Haplogroup IJ is a descendant branch of Haplogroup IJK YDNA Haplogroup IJK ref http www.isogg.org tree ISOGG YDNATreeTrunk08.html ISOGG Y tree showing HG IJK ref which in turn derives from the greater Haplogroup F YDNA Haplogroup F . Descendants are Haplogroup I YDNA Haplogroup I and Haplogroup J YDNA Haplogroup J . Haplogroup IJ derived populations account for a significant fraction ... IJ M429, P123, P124, P125, P126, P127, P129, P130, S2, S22 per ISOGG 2008 Haplogroup I YDNA I M170, P19, M258, P38, P212, U179 Haplogroup I notation updated to ISOGG 2008 I Haplogroup I1 YDNA ... YDNA I2 M438 P215 S31 formerly I1b I2 I2a P37.2 formerly I1b1 Typical of the South Slavs South Slavic ... Haplogroup J YDNA J 12f2.1, M304, S6, S34, S35 J Haplogroup J1 YDNA J1 M267 Typical of populations ... and East Africa J1 J1a M62 J1b M365 J1c M367, M368 J1d M369 J1e M390 Haplogroup J2 YDNA J2 M172 ... Y chromosome DNA haplogroups YDNA haplogroups by ethnic groups Haplogroup I YDNA Haplogroup I1 YDNA Haplogroup I2 YDNA Haplogroup J YDNA Haplogroup J2 YDNAYDNA DEFAULTSORT Haplogroup Ij YDna Category Human YDNA haplogroups IJ hi it Aplogruppo IJ YDNA ru IJ Y .... Origin It is notable that no example of a Haplogroup IJ haplogroup Y chromosome has been found ... the fact that certain mutations are shared in common among all Y chromosomes belonging to the descendant ... FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF title New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree journal Genome Research year 2008 volume ... more details
YDNA haplogroup P and it is defined by the M207 singlenucleotide polymorphism SNP mutation . Origins ...Infobox haplogroup name R map Haplogroup R YDNA .jpg origin date 26,800 19,900 34,300 years ago ref ... Asia ancestor haplogroup P YDNA P which origin is believed to be in west central Asia descendants R , Haplogroup R1 YDNA R1 , haplogroup R2 YDNA R2 mutations R M207 UTY2 , P224, P227, P229, P232, P280, P285, S4, S8, S9 and V45. ref name ISOGG 2010 br Haplogroup R1 YDNA R1 M173 br haplogroup R1a YDNA R1a L62, L63 br haplogroup R1b YDNA R1b M342 br haplogroup R2 YDNA R2 M479 br haplogroup R2a YDNA R2a L266, M124, P249, and P267. members In human genetics , haplogroup R is a Human Y chromosome DNA haplogroup Y chromosome DNA haplogroup very common throughout Europe , Central Asia and South ... in Central Asia or South Asia, where its ancestor haplogroup P YDNA Haplogroup P is most often ... R 1 label2 Haplogroup R1 YDNA Haplogroup R1 2 Clade 1 Paragroup R1 2 Clade label1 Haplogroup R1a YDNA Haplogroup R1a 1 Clade 1 Paragroup R1a 2 Haplogroup R1a1 YDNA Haplogroup R1a1 3 Clade label1 Haplogroup R1b YDNA Haplogroup R1b 1 Clade 1 Paragroup R1b 2 Haplogroup R1b1 YDNA Haplogroup R1b1 label3 Haplogroup R2 YDNA Haplogroup R2 3 Clade 1 Paragroup R2 2 Clade label1 Haplogroup R2a YDNA Haplogroup R2a 1 Clade 1 Paragroup R2a 2 Haplogroup R2a1 YDNA Haplogroup R2a1 Distribution ... . ref R1 Image Haplogroup R YDNA .PNG thumb 350px Spread of Haplogroup R in Native populations ... R1 YDNA The majority of members of haplogroup R belong to its subgroup R1, defined by marker ... R1a YDNA R1a1a M17 and Haplogroup R1b YDNA R1b1b2 M269. ref name Semino2000 Harvcolnb Semino et ... haplogroup in Indigenous peoples of the Americas following Haplogroup Q YDNA haplogroup Q , and spreads ... Haplogroup R1a YDNA The highest levels of R1a 50 are found across the Eurasian Steppe and South Asia ... more details
mutations P16 G2a1 , P18 G2a1a In human genetics , Haplogroup G2a1 P16 is a Y chromosome haplogroup . It is a branch of haplogroup G YDNA M201 , and more specifically of haplogroup G2 P287 and most ... also have the distinctive mutation at Singlenucleotide polymorphism SNP P16 that characterizes G2a1 .... In the Nasidze study of YDNA in various Caucasus groups, ref name Nasidze, I. et al. 2004 ... ref See also genetic genealogy YDNA haplogroups by populations of the Caucasus Haplogroup G YDNA ... YDNA Haplogroup G and its subclades from the 2011 ISOGG haplotree http www.ysearch.org haplosearch results.asp?haplo G®ion &submit Search&uid Y Search Users with Haplogroup G DEFAULTSORT Haplogroup G2a1 YDna Category Human YDNA haplogroups G2a1 ... archiver.rootsweb.ancestry.com url http archiver.rootsweb.ancestry.com th read GENEALOGY DNA 2007 07 ... a common pool of Y chromosome biallelic haplotypes journal Proc Natl Acad. Sci. USA volume 97 issue ... 2000PNAS...97.6769H ref These are the specifications listed for P16 located on the Y chromosome at 19434578 ... Karafat, T., et al. title New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree journal Genome Research volume 18 issue 5 pages 830 38 year 2008 pmid ... cite journal author The Y Chromosome Consortium title A Nomenclature System for the Tree of Human Y ... on the Y chromosome at 25751219 25029753 23396005....forward primer is tggatctgattcacaggtag ... of the Caucasus in different time periods as they migrated from the east. Examination of ancient DNA .... ref cite journal author Keyser C, et al. title Ancient DNA provides new insights into the history ... S, Crub zy E, Ludes B title First successful assay of Y SNP typing by SNaPshot minisequencing on ancient DNA journal Int. J. Legal Med. volume 121 issue 6 pages 493 9 year 2007 month November pmid ... in the area to the north of the Caucasus lacks both features. Famous members See also List of genetic ... more details
. These subclades are also defined by singlenucleotidepolymorphisms SNPs or unique event ...Infobox haplogroup name Q map Haplogroup Q YDNA .PNG origin date 17,000 to 22,000 years ago ref name ... to a Single, Recent Entry of Native American Y Chromosomes into the Americas year 2003 last1 Zegura ... http www.isogg.org tree ISOGG HapgrpQ.html YDNA Haplogroup Q and its Subclades 2010 ref the Indian Subcontinent , ref name Sharma07 Siberia ref name Genebase cite web title Learn about YDNA Haplogroup ... before present ref ancestor haplogroup P YDNA P descendants Q1 P36.2 , Q mutations M242 members Indigenous ... Q M242 is a Human Y chromosome DNA haplogroup Y chromosome DNA haplogroup . Origins Haplogroup Q is one of the two branches of Haplogroup P YDNA haplogroup P M45 . Haplogroup Q is believed to have ... C T Q1a3a Q1a3a L53, L54, L55 The M3 SNP defines the dominant YDNA subclade of Haplogroup Q for the indigenous ... binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree year ... on the ISOGG YDNA tree. ref Private communication reported between Charles Moore, of ISOGG, and Rebekah Adele Canada, of the FTDNA YDNA Q Project. ref Further, analysis of STR based haplotypes ... index.php?name Draft&parent 31182976 Proposed Tree for haplogroup Q. Haplogroup P YDNA P ... url https www.familytreedna.com ydna haplotree.aspx title YDNA Haplotree Family Tree DNA uses the Y Chromosome Consortium tree and posts it on their website. ref Haplogroup P YDNA P Q M242 Q1 ... Q1a3 YDNA Q1a3 L56, L57, M346, L528 Q1a3a L53, L54, L55, L213, L331 Haplogroup Q1a3a YDNA Q1a3a1 ... , West Asia , and in Europe . The Americas See Indigenous Amerindian genetics YDNA haplogroups ... . ref name genetree cite web title Frequency Distribution of YDNA Haplogroup Q M3 url http www.genetree.com ..., producing its descendant population defined by the M3 singlenucleotide polymorphism SNP . ref ... haplotypes point to a single, recent entry of Native American Y chromosomes into the Americas journal ... more details
DE is a human Y chromosome DNA haplogroup . It is defined by the singlenucleotide polymorphism SNP ... or Asia ancestor Haplogroup CT YDNA CT descendants Haplogroup D YDNA D , Haplogroup E YDNA E mutations ... can be categorized as being in either Haplogroup D YDNA , which likely originated in Asia , the only place where it has been found, ref name Karafet or Haplogroup E YDNA haplogroup E , which is believed ... was based on the fact that older African lineages, such as Haplogroup A YDNA haplogroups A and Haplogroup B YDNA B , were YAP negative whereas the younger lineage, Haplogroup E YDNA haplogroup ... M174 mutation that defines haplogroup D YDNA haplogroup D . The M174 allele is found in the ancestral ... migration to Africa, and at the time of writing that there was no unequivocal Y chromosome YDNA ... haplogroup C YDNA Haplogroup C seems to have originated in Asia at a similar time to Haplogroup .... These include haplogroup R1b YDNA Haplogroup R1b1 18 23kya , which has been observed with especially high frequency among the members of some tribes in northern Cameroon , and Haplogroup T YDNA Haplogroup ... research. DE M1 YAP, M145 P205 , M203, P144, P153, P165, P167, P183 Haplogroup D YDNA D M174, 021355 Haplogroup E YDNA E SRY4064, M96, P29, P150, P152, P154, P155, P156, P162 YDNA See also Haplogroup D YDNA Haplogroup E YDNA References reflist External links DEFAULTSORT Haplogroup De YDna Category Human YDNA haplogroups DE ca Haplogrup DE del cromosoma Y hum es Haplogrupo DE ADN Y fr Haplogroupe ... well known unique event polymorphism UEP which defines it, the Y chromosome Alu Polymorphism biology Polymorphism YAP . The YAP mutation was caused when a strand of DNA called Alu sequence Alu , which copies itself, inserted a copy into the Y chromosome . A Y chromosome that has the YAP mutation is called YAP positive YAP , and a Y chromosome that does not have the YAP mutation is labeled ... Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF title New binary polymorphisms ... more details
small 1 R1a label2 small M343 small 2 Haplogroup R1b YDNA R1b label3 ? 3 R1 2 Haplogroup R2 YDNA Haplogroup R2 R1a, distinguished by several unique markers including the M420 mutation, is a subclade of Haplogroup R1 YDNA Haplogroup R1 , which is defined by single ... Norse origins. See also Clear right List of R1a frequency by population Human Y chromosome DNA ...Infobox haplogroup name R1a map Haplogroup R1a YDNA .jpg origin date Less than 18,500 YBP ref http www.nature.com ... probably South Asia , Central Eurasia or Southwest Asia ancestor Haplogroup R1 YDNA R1 R M173 mutations ... by the Singlenucleotide polymorphism SNP mutation M17, is particularly common in a large region ... most broadly by the Singlenucleotide polymorphism SNP mutation M420. The recent discovery of M420 ... at marking positions in a family tree. Names of singlenucleotide polymorphism SNP mutations can ... Clade label1 br Haplogroup R YDNA Haplogroup R 1 Clade label1 ... R1b YDNA R1b , defined by the M343 mutation, and the paragroup R1 . There is no simple consensus concerning ... by population further2 YDNA haplogroups by ethnic groups R1a has been found in high frequency ... study as of December 2009, including a collation of retested YDNA from previous studies, concluded ... Corded Ware period human remains at Eulau from which YDNA was extracted of R1a haplogroup appear ... by populations Nordic R1a YDNA Project Somerled center YDNA center Notes Reflist group note ... first7 A.S. title Y chromosome and mtDNA polymorphisms in Iraq, a crossroad of the early human dispersal ... Genealogy ISOGG title YDNA Haplogroup R and its Subclades accessdate 8 January 2011 ref Citation ... Kucinskas year 2005 first2 V. last3 Stoneking first3 M. title Y Chromosome and Mitochondrial DNA Variation ... Asia , Eastern Europe , Central Asia , Central Europe , Scandinavia and Siberia See List of R1a frequency by population Haplogroup R1a is the phylogenetic name of a major clade of Human Y chromosome ... more details
15 Learn about YDNA Haplogroup G Genebase.com ref origin place South Asia or Southwest Asia ancestor Haplogroup F YDNA F brother groups Haplogroups H, IJ parent of I and J , and K descendants G1 ... , Haplogroup G M201 is a Y chromosome haplogroup . It is a branch of Haplogroup F YDNA Haplogroup F ... so far yielded YDNA belong to haplogtoup G2a. There are only a few samples from this period because ... of ancient YDNA from Treilles , the type site of a Late Neolithic group of farmers in the South of France ... , L177.2 , L177.3 G2b M287 Haplogroup G2c YDNA G2c M377, L72, L183 G2c G2c1 M283 The indicates ... Z1903 and G2c YDNA G2c M377 . Characteristics of Haplogroup G Subgroups The International ... new L or S designated SNP tests. In 2009 10, Family Tree DNA s Walk through the Y Project, sequencing ... and its subgroups Main Haplogroup G1 YDNA Almost all haplogroup G1 persons have the value of 12 at short tandem repeat STR marker DYS392 and all will have the M285 or M342 Singlenucleotide polymorphism ... and its subgroup Main Haplogroup G2a1 YDNA Haplogroup G2a1 and its one subgroup G2a1a represent the majority ... LBK . ref name Haak, W. 2010 G2a3a M406 and its subgroups Main Haplogroup G2a3a YDNA G2a3a and its ... Main Haplogroup G2a3b1 YDNA The G2a3b1 definable subgroups are heavily concentrated throughout Europe ... subgroup Main Haplogroup G2c YDNA A clade of closely related Ashkenazi Jews represent virtually all Haplogroup G2c YDNA G2c persons, with just three other G2c haplotypes having been reported so far ... list of Y STR markers marker , a missing T allele of the DYS371 palindromic list of Y STR ... Main Haplogroup G YDNA Country by Country Knowing the distribution of haplogroup G in general is not as useful ... test on his grandson his son Vasily s son Alexander Burdonsky , shows his YDNA haplogroup to be G2a1a ... from Genebase http www.isogg.org tree ISOGG HapgrpG.html YDNA Haplogroup G and its subclades from ... Search&uid Y Search Users with Haplogroup G http www.britishislesdna.com British Isles DNA Project ... more details
Haplogroup G YDNA brother subgroup Haplogroup G2 descendants G1a, G1b, G1c mutations M285 G1 , P20 ... G1 M285 is a Y chromosome haplogroup . G1 is a branch of Haplogroup G YDNA M201 . Haplogroup G1 ... marker DYS392 and all will have the M285 Singlenucleotide polymorphism SNP mutation which characterizes ... s00439 009 0727 5 pmc 2771134 ref See also page covering Jews with Haplogroup G YDNA . Among available ... genealogy YDNA haplogroups by ethnic groups Haplogroup G YDNA Country by Country References Reflist ... from Genebase http www.isogg.org tree ISOGG HapgrpG.html YDNA Haplogroup G and its subclades ... Y Search Users with Haplogroup G DEFAULTSORT Haplogroup G1 YDna Category Human YDNA haplogroups ... ID number is rs13447378.....Y position is 21151128....The forward primer sequence is ttatcctgagccgttgtccctg ... Karafat, T., et al. 2008 830 38 cite journal author Karafat, T., et al. title New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree journal Genome Research ... journal author Cinnioglu, C., et al. title Excavating Y chromosome haplotype strata in Anatolia journal ... Tree DNA . Dating of G1 Origin While research studies have not yet dated the origin of G1 s M285 ... Country by Country The highest reported concentration of G1 and its subgroups in a single country ... nexus for Y chromosome driven migration journal Hum. Hered. volume 61 issue 3 pages 132 ... Y chromosome haplotype strata in Anatolia journal Human Genetics volume 114 pages 127 48 year 2004 ... Sibai2009 cite journal author El Sibai, M., et al. title Geographical structure of the Y chromosomal ... name Biro 2009 cite journal author Biro, A. Zalan, A., et al., title A Y Chromosomal Comparison of the Madjars ... DNA 2007 07 1185576938 Report of Thomas Krahn ref P20 results may be reported as P20.1, P20.2 and P20.3, and persons may have varying results for each. The technical features of P20 are Y position ... was identified at the University of Arizona and first reported by the Y Chromosome Consortium in 2002 ... more details
Rootsi ancestor Haplogroup K xLT YDNA K xLT descendants Haplogroup N YDNA N , Haplogroup O YDNA ... is a Human Y chromosome DNA haplogroups human Y chromosome DNA haplogroup . Haplogroup NO is a descendant branch of the greater Haplogroup MNOPS YDNA Haplogroup MNOPS also known as K xLT and a phylogenetic sibling of haplogroup M YDNA Haplogroup M , Haplogroup P YDNA Haplogroup P , and haplogroup S YDNA Haplogroup S . Origins The M214 mutation that defines Haplogroup NO occurred in a gamete of a man who belonged to Haplogroup K xLT YDNA Haplogroup K xLT and who probably lived somewhere in Asia ... N YDNA Haplogroup N and Haplogroup O YDNA Haplogroup O , which together are overwhelmingly dominant ... origins of the Japanese common ground for hunter gatherer and farmer Y chromosomes, The Japan Society of Human Genetics, Springer Verlag 2005 ref Haplogroup NO M214 xN1 LLY22g, O M175 YDNA also has ..., Murray P. Cox et al. , Major East West Division Underlies Y Chromosome Stratification Across ... cgi content abstract gr.7172008v1 Abstract New Binary Polymorphisms Reshape and Increase Resolution of the Human Y Chromosomal Haplogroup Tree , Genome Research, DOI 10.1101 gr.7172008 ref and subsequent published research. NO M214, P188, P192, P193, P194, P195 NO N M231 Haplogroup N YDNA Main N Article O M175, P186, P191, P196 Haplogroup O YDNA Main O Article References reflist See also Human Y chromosome DNA haplogroup Genealogical DNA test Y chromosome haplogroups by populations YDNA External links Category Human YDNA haplogroups NO es Haplogrupo NO ADN Y hi ru NO Y ... more details
10.1101 gr.7172008 title New binary polymorphisms reshape and increase resolution of the human Y chromosomal ... Haplogroup DE YDNA DE descendants Haplogroup E1 YDNA E1 , Haplogroup E2 YDNA E2 mutations L339 ..., P173, P174, P175, P176 members In human genetics , Haplogroup E M96 is a human Y chromosome DNA ... branch being Haplogroup D YDNA haplogroup D . The E clade is divided into two clades subclades ..., with the other major clade, Haplogroup D YDNA haplogroup D , being East Asian. DE is a clade within Haplogroup CT YDNA M168 with the other two major clades, C and F, considered to have a Eurasian origin ... 10.1146 annurev.genet.41.110306.130407 title Use of Y Chromosome and Mitochondrial DNA Population ... 250px Haplogroup E YDNA . Most members of haplogroup E belong to one of its identified subclades ... main Haplogroup E1 YDNA E1a main Haplogroup E1a YDNA While there have been no attested exemplars ... E1b main Haplogroup E1b YDNA So far there are no attested examples of E1b . The clade is dominated ... subclade of E1b, E1b2 P75 , is much more unusual. E1b1 main Haplogroup E1b1 YDNA E1b1, also known ... V38 . E1b1a main Haplogroup E1b1a YDNA E1b1a is the primary subclade of E in West Africa ns and many ... E1b1a1a1f E L485 or E1b1a1a1g E U175 . E1b1b main Haplogroup E1b1b YDNA E1b1b is a primary subclade ... Haplogroup E2 YDNA E2 M75 is present throughout Sub Saharan Africa, in East Africa, Southern Africa ..., P175, P176 Haplogroup E1 YDNA E1 P147 Haplogroup E1a YDNA E1a M33, M132 E1a1 M44 E1a2 P110 E1a3 L94 E1a4 L133 PAGES00074 Haplogroup E1b YDNA E1b P177 Haplogroup E1b1 YDNA E1b1 DYS391p, P2 PN2, P179, P180, P181 Haplogroup E1b1a YDNA E1b1a L222.1, V38, V100 E1b1a1 DYS271 M2 SY81, V95, V43, M180 ... P268, P269 E1b1a2 M329 Haplogroup E1b1b YDNA E1b1b M215 PAGES00040 E1b1b1 M35.1, M243, L336 Haplogroup E1b1b1a YDNA E1b1b1a V68 E1b1b1a1 L18, M78 E1b1b1a1a V12 E1b1b1a1a1 M224 E1b1b1a1a2 V32 E1b1b1a1b ... M293 E1b1b1e1 P72 E1b1b1f V42 E1b1b1g V92 E1b1b2 M281, V16 E1b2 P75 Haplogroup E2 YDNA E2 M75 ... more details
Basin and North East to Manchuria. The descendant haplogroups of P include haplogroup Q YDNA Q M242 and haplogroup R YDNA R M207 . Distribution Haplogroup P is distributed commonly in Europe, Central ..., P282, P283, P284, P295 S8, PG83 P haplogroup Q YDNA Q M242 haplogroup R YDNA R M207, P224, P227 ... Geographic magazine National Geographic YDNA Category Human YDNA haplogroups P ca Haplogrup P del cromosoma Y hum cs Haploskupina P YDNA de Haplogruppe P YDNA es Haplogrupo P ADN Y fr Haplogroupe P hi ru P Y ... cite journal doi 10.1073 pnas.0507714103 title A prehistory of Indian Y chromosomes Evaluating demic ... more details
E1b1 YDNA E1b1 descendants E1b1a1, E1b1a2 mutations L222.1, V38, V100 members In human genetics , Haplogroup E1b1a is a Human Y chromosome DNA haplogroups human Y chromosome DNA haplogroup . It is the phylogenetic term for the series of unique sequence variants on the human Y chromosome . It is often ... Y Chromosome Haplogroup E1b1 E P2 Revealed through the Use of Newly Characterized Binary Polymorphisms ... Genealogy first author link title YDNA Haplogroup E and its Subclades 2010 date 3 February 2010 url ... of the YDNA haplogroups Haplogroup A YDNA A1a , A1b, A2, A3, and Haplogroup B YDNA B M60 ... Neolithic Origin for Y Chromosomal DNA Variation in North Africa journal American Journal ... Iraqis 1.4 2 139 ref name AlZahery2003 cite journal title Y chromosome and mtDNA polymorphisms in Iraq ... American population mitochondrial DNA, Y chromosome and HTLV 1 analysis in the Noir Marron ... accessdate ref E1b1a2 E1b1a2 is defined by the singlenucleotide polymorphism SNP mutation M329. ref ... pmc 2336805 ref the ISOGG YDNA Haplogroup E Tree, ref name International Society of Genetic ... E1b1a1a1g1d V39 L609, L611 E1b1a1a1h P268, P269 E1b1a2 M329 YDNA See also Human Y chromosome DNA ... E3a , from National Geographic magazine National Geographic DEFAULTSORT Haplogroup E1b1a YDna Category Human YDNA haplogroups E1b1a ca Haplogrup E3a del cromosoma Y hum ... Y chromosomal diversity in the population of Guinea Bissau a multiethnic perspective journal BMC Evolutionary ... ref ref name Semino2004 cite journal title Origin, Diffusion, and Differentiation of Y Chromosome ... Montano2011 cite journal title The Bantu expansion revisited a new analysis of Y chromosome variation ... the pre existing population Y chromosomal diversity in Western, Central, Southern and southern East ... Wood2005 cite journal title Contrasting patterns of Y chromosome and mtDNA variation in Africa evidence ... journal title The phylogeography of Y chromosome binary haplotypes and the origins of modern human ... more details
Infobox haplogroup name T map Distribution Haplogroup T YDNA II.svg origin date 19,000 34,000 years ... humbiol vol83 iss1 3 ref ancestor Haplogroup LT YDNA LT descendants T1, T mutations ... In human genetics , Haplogroup T is a Human Y chromosome DNA haplogroups human Y chromosome DNA ... UEP which defines this clade is generally considered to be the singlenucleotide polymorphism SNP ... YDNA R1 , Haplogroup J YDNA G and Haplogroup J YDNA J lineages that entered Africa from Eurasia .... Later expansions of populations carrying the Haplogroup E1b1b YDNA E1b1b , Haplogroup E1b1a YDNA E1b1a , G and J NRY lineages may have overwhelmed the T clade bearers in certain localities ... groups of India inference from Y chromosome and mitochondrial DNA S1 , BMC Genetics 2006 ref 20 1 5 ... South Tyrolean Isolated Populations Revealed by Analysis of Y Chromosome, mtDNA, and Alu Polymorphisms ... index.php?title Haplogroup T YDNA &action edit& Rhineland ers Ripuarian language Ripuarian Central ... DNA and Y Chromosomes in Russian Populations , Human Biology, Volume 76, Number 6 2005 ref 12.5 3 24 ... Barac Lauc et al. Y chromosome STR polymorphisms in a Serbian population sample , Forensic Science ... . ref name UtaD.Immel2005 Uta Dorothee Immel et al. Y chromosome polymorphisms and haplotypes in South ... et al. , Y Chromosome and Mitochondrial DNA Variation in Lithuanians, Annals of Human Genetics ... al. , Population Structure in Contemporary Sweden A Y Chromosomal and Mitochondrial DNA Analysis, Annals ... MURCI1999 L. QUINTANA MURCI et al., Y chromosome speci c YCAII, DYS19 and YAP polymorphisms in human ... P. P., High resolution analysis of Y chromosomal polymorphisms reveals signatures of population ... E. Weale et al. , Armenian Y chromosome haplotypes reveal strong regional structure within a single ... of Iran ians in Isfahan , ref name Nasidze 2004 Nasidze et al. Mitochondrial DNA and Y Chromosome Variation ... publications HM 2001 v17 p271.pdf Maori origins, Y chromosome haplotypes and implications for human ... more details
Encyclopedia
top
