al. ref name DhLaFuInIn1987 MulticopysinglestrandedDNA msDNA is a type of extrachromosomal satellite DNA that consists of a singlestrandedDNA molecule covalently linked via a 2 5 phosphodiester bond to an internal guanosine of an RNA molecule. The resultant DNA RNA chimera possesses two stem loop ... MulticopySingleStrandedDNA Strain Present in Yersinia frederiksenii ATCC 33641 Contig01029 Enteropathogenic ... in myxobacteria , ref cite journal author Yee T, Furuichi T, Inouye S, Inouye M title MulticopysinglestrandedDNA isolated from a gram negative bacterium, Myxococcus xanthus journal Cell volume ... and structure of stable branched RNA covalently linked to the 5 end of multicopysinglestrandedDNA of Stigmatella aurantiaca journal Cell volume 48 issue 1 pages 55 62 year 1987 month January ... T, Hosen S, Arifuzzaman M title Comparative Study of different msDNA multicopysinglestrandedDNA structures and phylogenetic comparison of reverse transcriptases RTs evidence for vertical ... T, Kawanishi H, Tsuchiya T, Inouye S, Inouye M title In Vitro Synthesis of MulticopySingleStrandedDNA, Using Separate Primer and Template RNAs, by Escherichia coli Reverse Transcriptase journal ... archaebacteria . After a DNA fragment coding for the production of msDNA in E. coli was discovered, ref cite journal author Hsu MY, Inouye M, Inouye S title Retron for the 67 base multicopysinglestrandedDNA from Escherichia coli a potential transposable element encoding both reverse transcriptase ... strandedDNA at 3.0 A resolution shows bent DNA journal Proc. Nat. Acad. Sci. USA volume 90 ... related Myxococcus xanthus. The hypervariable domain in the DNA sequence is shaded gray. The highly ... left Biosynthesis of msDNA is purported to follow a unique pathway found nowhere else in DNA ... to our understanding of DNA synthesis. DNA polymerase s which include RT share highly conserved ..., or even between DNA polymerases using DNA as a template, versus DNA polymerases using RNA as a template ... more details
File TsDNA.png thumb right 110px Schematic of triple strandedDNA. A triple strandedDNA is a structure of DNA in which three oligonucleotides wind around each other and form a triple helix . In this structure, one strand binds to a DNA B form DNA double helix through Hoogsteen base pair Hoogsteen or reversed Hoogsteen hydrogen bonds . For example, a nucleobase T binds to a Base pair Watson Crick base pairing of T A by Hoogsteen base pair Hoogsteen hydrogen bonds between an AxT pair x represents a Hoogsteen base pair . An N 3 protonated cytosine , represented as C , can also form a base triplet with a C G pair through the Hoogsteen base pair Hoogsteen base pairing of an GxC . Thus, the triple helical DNAs using these Hoogsteen base pair Hoogsteen pairing s consist of two homo pyrimidine s and one homo purine , and the homo pyrimidine third strand is parallel to the homo purine strand. A homo ... strand is antiparallel to the homo purine strand of the original duplex. Triple strandedDNA was a common hypothesis in the 1950s when scientists were struggling to discover DNA s true structural from ... Acids. Triple strandedDNA was also described in 1957, when it was thought to occur in only one ... enzyme RecA . Its role in that process is not understood. Using nucleic acid segments that bind to the DNA ... by biotechnology companies. Similar work is also being undertaken at Yale University . Triple strandedDNA has been implicated in the regulation of several genes. One, the c myc gene has been extensively mutated to examine the exact role that triplex DNA structure, versus linear sequence, plays in gene ... tandem intramolecular triplexes of the H DNA type and has a repeating sequence motif ACCCTCCCC 4. The NSE ... to form H DNA and not by repeat number, position, or the number of mutant base pairs. DNA may therefore be a dynamic participant in the transcription of the c myc gene. References Rich, A. 1993 . DNA ... DNA it DNA a tripla elica tr sarmall DNA ... more details
wiktionary strandedStranded may refer to tocright Music Stranded album Stranded album , a 1973 album by Roxy Music I m Stranded , the first album by Australian rock group The Saints I m Stranded song I m Stranded song , the first single from the album Stranded Agnes Carlsson song Stranded Agnes Carlsson song , the second single by the Swedish Idol winner Agnes Carlsson Stranded , a 2000 song by the British synthpop band Blue October UK Stranded Haiti Mon Amour , a 2010 song by Jay Z, Bono, Rihanna and The Edge Stranded Heart song Stranded Heart song , a 1990 single by American rock band Heart Stranded Plumb song Stranded Plumb song , a song by Plumb from the album candycoatedwaterdrops , later covered and released as a single in 2002 by Jennifer Paige Stranded Van Morrison song Stranded Van Morrison song , a song from Van Morrison s 2005 album Magic Time Stranded The Secret History of Australian ... Stranded television program Stranded television program , a five part survival miniseries broadcast on Discovery Channel Canada Stranded TV film , a 2002 made for television film, starring Liam Cunningham and Jesse Spencer Stranded with Cash Peters , a travel show Stranded Jimmy Neutron episode Stranded Jimmy Neutron episode Stranded The Outer Limits Stranded The Outer Limits , a 1999 episode of The Outer Limits television series The Stranded , the twenty seventh episode of the sitcom Seinfeld Film Stranded film Stranded film , a 1916 film starring Oliver Hardy Stranded 1935 film Stranded 1935 film , a 1935 film directed by Frank Borzage Stranded N ufragos , 2002 science fiction movie starring Vincent Gallo and Maria de Medeiros Stranded 2005 film Stranded 2005 film , the Best Australian Short Film of the Film Critics Circle of Australia Awards 2006 Stranded I ve Come from a Plane that Crashed in the Mountains , a 2008 documentary Video gaming Stranded video game Stranded video game , a 2003 3D adventure game developed by Unreal Software, or Stranded II, its sequel disambiguation de ... more details
to Guanine G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M405 See also Single nucleotide polymorphism Unique event polymorphism Human Y chromosome DNA haplogroup s List of Y STR markers External ... M series markers published by 2001 http www.isogg.org tree ISOGG YDNA SNP Index07.html ISOGG Y DNA ... Data Category DNA Category Human evolution Category Population genetics Category Genetic genealogy ... more details
For the Virgin Comics series now becoming a Sci Fi Channel United States Sci Fi Channel pilot, see The Stranded comic . Infobox Television episode Title The Stranded Series Seinfeld Image Caption Season 3 Episode 10 Airdate November 27, 1991 Production 209 Writer Larry David & Jerry Seinfeld and Matt Goldman Director Tom Cherones Guests Michael Chiklis Episode list Seinfeld season 3 Seinfeld season 3 br List of Seinfeld episodes List of Seinfeld episodes Prev The Nose Job Next The Alternate Side The Stranded is the 27th episode of the sitcom Seinfeld . It is the tenth episode of the show s third season. It first aired on November 27, 1991. The episode was originally produced for Season 2 but was postponed because Larry David was dissatisfied with the episode, ref cite web url http www.sonypictures.com tv shows seinfeld episode guide ?sl episode&ep 209 title The Stranded episode at Seinfeld Official Site publisher Sony Pictures accessdate 2008 03 23 ref and was therefore advertised as a lost episode. The episode was written by Larry David , Jerry Seinfeld and Matt Goldman and was directed by Tom Cherones . Besides the usual cast, other actors in the episode include Michael Chiklis , Bobbi Jo Lathan , Gwen Shepherd , and Marcia Firesten . Plot The episode begins with Jerry Seinfeld character Jerry and George Costanza George at a drug store to purchase medicine where George becomes involved in an altercation with the cashier played by Gwen Shepherd , accusing her of short changing him ten dollars. He is removed by the security guard. George gets invited to a party in Long Island and brings Elaine Benes Elaine and Jerry with him. Jerry and Elaine have a bad time stuck in boring conversations, and Elaine confronts a woman because of her fur coat. At one point during the party, Elaine does an impression from the film A Cry in the Dark and exclaims Maybe the dingo ate your baby ... DEFAULTSORT Stranded Category Seinfeld season 3 episodes Category 1991 television episodes ... more details
Image A DNA orbit animated small.gif right frame The A DNA structure. A DNA is one of the many possible double helical structures of DNA . A DNA is thought to be one of three biologically active double helical structures along with B DNA B and Z DNA . It is a right handed double helix fairly similar to the more common and well known B DNA form, but with a shorter more compact helical structure. It appears likely that it occurs only in dehydrated samples of DNA, such as those used in crystallographic experiments, and possibly is also assumed by DNA RNA hybrid helices and by regions of double stranded RNA. Structure A DNA is fairly similar to B DNA given that it is a right handed double helix with major ... turn. This results in a deepening of the major groove and a shallowing of the minor. Predicting A DNA structure An algorithm for predicting the propensity of a sequence to flip from B DNA to A DNA ... cite journal author Basham B, Schroth GP, Ho PS title An A DNA triplet code thermodynamic rules for predicting A and B DNA journal Proc Natl Acad Sci USA volume 92 issue 14 pages 6464 6468 year ... in the hydration of DNA surfaces can be used to distinguish between sequences that form A and B DNA. From this, a triplet code of A DNA propensities was derived as energetic rules for predicting A DNA formation. This code correctly predicted 90 of A and B DNA sequences in crystals and correlates with A DNA formation in solution. Thus, with our previous studies on Z DNA, we now have a single method to predict the relative stability of sequences in the three standard DNA duplex conformations. ref name Basham1995 blockquote Comparison Geometries of the Most Common DNA Forms Image A DNA, B DNA and Z DNA.png right thumb Side view of A , B , and Z DNA. Image B&Z&A DNA formula.jpg thumb right 250px The helix axis of A , B , and Z DNA. class wikitable Geometry attribute A form B form Z form Helix ... also Mechanical properties of DNADNA B DNA Z DNA External links http www.tulane.edu biochem nolan ... more details
entirely independent molecules. These Anchor ssDNA singlestrandedDNA molecules ssDNA have no single ... J, Acharya S, Barman J, Cheruku P, Chattopadhyaya J title Singlestranded adenine rich DNA and RNA ... human body human cells , telomeres are usually lengths of singlestrandedDNA containing several .... Here, the singlestrandedDNA curls around in a long circle stabilized by telomere binding proteins ... In living organisms DNA does not usually exist as a single molecule, but instead as a pair of molecules ... s that can bind to specific sequences in double strandedDNA usually make contacts to the sides ... H title Mechanical stability of singleDNA molecules pmc 1300792 journal Biophys J volume 78 issue ... ref As a result of this complementarity, all the information in the double stranded sequence of a DNA ... stranded telomere DNA is held onto a region of double strandedDNA by the telomere strand disrupting the double helical DNA and base pairing to one of the two strands. This Triple strandedDNA triple ... as their parent. The double stranded structure of DNA provides a simple mechanism for DNA replication ... can be non specific, or the protein can bind specifically to a singleDNA sequence. Enzymes can ... June 2, 2012 small yes pp move indef File DNA Structure Key Labelled.pn NoBB.png thumb right 340px The structure of the DNA double helix . The atoms in the structure are colour coded by Chemical element ... thumb The structure of part of a DNA double helix Deoxyribonucleic acid IPAc en audio en us Deoxyribonucleic acid.ogg d i k s i r a b . n ju k l e . k s d DNA is a nucleic ... known living organism s with the exception of RNA virus es . The DNA segments carrying this genetic information are called gene s. Likewise, other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. Along with RNA and proteins , DNA is one of the three major macromolecules that are essential for all known forms of life . DNA consists of two long ... more details
Infobox Single See Wikipedia WikiProject Songs Name Stranded in the Jungle Cover Artist The Cadets from Album Rockin N Reelin B side I Want You Released 1956 Format Gramophone record 7 Recorded Genre R&B music R&B Length 2 45 Label Modern Records Modern Writer James Johnson, Ernestine Smith Certification Last single Dancin Dan br 1956 This singleStranded in the Jungle br 1956 Next single Heaven Help Me br 1957 Stranded in the Jungle is a song originally recorded by American doo wop group The Jay Hawks . It peaked at 18 on the U.S. Billboard Hot 100 pop chart . A cover version of the song recorded by American doo wop group The Cadets in 1956 peaked at 15 on the U.S. pop chart and at 3 on the U.S. Hot R&B Hip Hop Songs Rhythm and Blues chart . The song features spoken verses by Will Dub Jones singer Will Dub Jones with a duet refrain by Willie Davis and Aaron Collins . It was during the final refrain of the song that Prentice Moreland delivers the line, Great googly moogly, get me outta here Stranded in the Jungle was covered by the New York Dolls in their 1974 album entitled Too Much Too Soon. The song is recorded in a glam rock style. In 1998 the Los Angeles based punk rock combo Voodoo Glow Skulls covered the song but with a much faster and harder tempo. External links http home.att.net uncamarvy JacksCadets jackscadets.html Marv Goldberg article on the Jacks Cadets Use dmy dates date September 2010 Category 1956 songs ... more details
Infobox album See Wikipedia WikiProject Albums Name Stranded Type studio Artist Roxy Music Cover Roxy Music Stranded.jpg Released start date 1973 11 1 df yes Recorded start date 1973 9 at AIR Studios , London, England London Genre Art rock , glam rock Length 41 06 Label Island Records Island , Polydor Records Polydor small UK small br Atco Records Atco , Reprise Records Reprise small U.S. small ref name strong07 cite book title The Essential Rock Discography last Strong first Martin C. year 2006 publisher Canongate location Edinburgh isbn 1841958603 page 930 ref Producer Chris Thomas record producer Chris Thomas Last album For Your Pleasure br 1973 This album Stranded br 1973 Next album Country Life Roxy Music album Country Life br 1974 Misc Singles Name Stranded Type studio Single 1 Street Life Roxy Music song Street Life Single 1 date start date 1973 11 ref name strong07 Album ratings rev1 Allmusic rev1score rating 4.5 5 ref name allmusic cite web title allmusic Stranded Review url Allmusic class album id r17009 pure url yes publisher Allmusic author Erlewine, Stephen Thomas accessdate March 17, 2010 ref rev2 Rolling Stone rev2score Rating 4 5 ref Brackett, Nathan. Roxy Music . The New Rolling Stone Album Guide . November 2004. pg. 705, cited March 17, 2010 ref rev3 Robert Christgau rev3Score B ref Christgau, Robert. http www.robertchristgau.com get artist.php?id 1183 Roxy Music . robertchristgau.com, Retrieved on March 17, 2010. ref rev4 Piero Scaruffi rev4score 7 10 ref Scaruffi ... Italian . Retrieved on March 17, 2010. ref Automatically generated by DASHBot Stranded is the third ... rated it as Roxy Music s finest record. The track Street Life was released as a single and reached ... Roxy Music albums Category Albums produced by Chris Thomas de Stranded Album it Stranded Roxy Music ja nn Stranded av Roxy Music pt Stranded ro Stranded ru Stranded fi Stranded albumi sv Stranded album ... more details
, Captain Oi Producer Mark Moffatt, Rod Coe Last album This album I m Stranded br 1977 Next album Eternally Yours br 1978 Misc Singles Name I m Stranded Type studio single 1 I m Stranded song I m Strandedsingle 1 date September 1976 single 2 Erotic Neurotic single 2 date May 1977 I m Stranded is the debut ... February 1977. Their debut single, I m Stranded song I m Stranded , was issued ahead of the album in September 1976, which Sounds magazine Sounds magazine s reviewer, Jonh Ingham , declared was the Single of this and every week . Erotic Neurotic was the second single, which was released in May 1977 ... McF EMI re issued the single, I m Stranded in February and it reached the Kent Music Report Top 100 Singles Chart. ref name Kent In May, the band released their second single, Erotic Neurotic and then moved ... a single disc EP and a double 7 with a gate fold sleeve. In 2007, I m Stranded was reissued as a CD ...Infobox album See Wikipedia WikiProject Albums Name I m Stranded Type studio Artist The Saints band The Saints ... replaced Bradshaw and the group issued a single, This Perfect Day song This Perfect Day in July, which ... Association APRA celebrated its 75th anniversary and named I m Stranded in its APRA Top 30 Australian songs Top 30 Australian songs of all time. In 2007, I m Stranded was one of the first 20 songs stored ... at No.  20 in the book, 100 Best Australian Albums , in October 2010. Background I m Stranded ..., The Saints recorded two tracks, I m Stranded song I m Stranded and No Time with Mark Moffatt producing ... released their debut single in September. ref name Howl Their self owned Eternal Promotions ... Kingdom. ref name McF In the UK, a small label, Power Exchange, issued the single. ref name Howl Sounds magazine Sounds magazine s reviewer, Jonh Ingham , declared it, Single of this and every ... recorded their first LP album, I m Stranded 21 February 1977 , with Rod Coe producing. ref ... single This Perfect Day song This Perfect Day July peaked at No.  34 in the UK but further improvement ... more details
unreferenced date December 2009 Infobox Album See Wikipedia WikiProject Albums Name Stranded on Earth Type studio Artist Valient Thorr Cover Stranded On Earth cover.jpg Released July 1, 2003 Recorded Genre Heavy metal music Heavy metal Length Label Producer Reviews Last album This album Stranded On Earth Next album Total Universe Man Stranded on Earth is an album by Valient Thorr , released in 2003. Track listing One Tuff Customer Bigger Badder Radiation Time Zone The Apprentice Don t Stop Stuck Running The Gauntlet Swallows Of Love Walk On Wine Stranded On Earth Ballad of the Morning Star Category 2003 albums Category Valient Thorr albums fr Stranded On Earth ... more details
episode episodes 3 episode list Infobox animanga Footer nihongo DNA D N A D En Ei ..., spanning a total of five tank bon volumes. DNA was adapted into a 12 episode anime television ... and animation director for the series was Kumiko Takahashi . DNA has been broadcast in Japan by Animax ... children that carry the Mega Playboy DNA, causing them and all their descendants to each have 100 children as well. All this started with a single Mega Playboy, whom Karin has travelled back into the past to deal with. Karin reveals to Junta that she is a DNA Operator . Her job is to make alterations in people s DNA that will change their nature for the greater good of society. She intends to shoot the original Mega Playboy with a DCM DNA Control Medicine bullet that will alter his DNA in order ... Playboy DNA stabilizes more and more. nihongo Karin Aoi Aoi Karin anime voices Miina Tominaga Jessica Calvello A sixteen year old DNA Operator from the overcrowded future, sent back in time in order ... DNA. She and Junta spend some time together trying to help cure each other of their problems. She ... Forgotten a Century from Now I ll Never Forget You Manga The DNA manga was published in Japanese ... es ca DNA cs DNA de DNA es DNA fr DNA ko DNA id DNA it DNA ja D N A pt DNA ru DNA fi DNA sv DNA tl DNA zh DNA ... more details
notability date August 2010 Image Stranded Comic 1.jpg thumb right 180px The Stranded 1 br Art by Marc Silvestri The Stranded is an USA American comic series created by Virgin Comics , and published by Diamond Comics. The series is in collaboration with the Sci Fi Channel United States Sci Fi Channel . It has been announced that The Stranded is being fast tracked into a pilot for the Sci Fi Channel, with the pilot to be written by comics series writer Mike Carey British writer Mike Carey . ref http blog.virgincomics.com 2008 03 20 stranded television series Mike Carey s THE STRANDED to Become a SCI FI Channel Television Pilot Virgin Comics Blog Bot generated title ref ref Brady, Matt. http forum.newsarama.com showthread.php?t 132255 The Virgin Days Of Mike Carey Talking The Stranded And Voodoo Child , Newsarama , 9 October 2007 ref The series is illustrated by artist Siddharth Kotian , and revolves around several aliens who are stranded on earth, as others from their planet arrive. See also Indian comics References reflist External links http www.virgincomics.com root stranded stranded.aspx?SQS The Stranded at Virgin Comics Homepage DEFAULTSORT Stranded Comics Category 2007 comic debuts Category Virgin Comics titles ... more details
Infobox film name Stranded image caption director Will Louis producer Louis Burstein writer starring Oliver Hardy music cinematography editing distributor released 14 September 1916 runtime country Film US language Silent film br English intertitles budget Stranded is a 1916 in film 1916 silent film silent comedy film featuring Oliver Hardy . Cast Oliver Hardy Plump as Babe Hardy Billy Ruge Runt Frank Hanson Millionaire Slocum Ray Godfrey Slocum s daughter Florence McLaughlin Slocum s daughter as Florence McLoughlin Robin Williamson An unwanted suitor Bert Tracy See also List of American films of 1916 Oliver Hardy filmography External links Imdb title id 0269917 title Stranded DEFAULTSORT Stranded Film Category 1916 films Category American silent short films Category American films Category Black and white films Category 1910s comedy films Category 1910s short films Category Screenplays by Anita Loos Short silent comedy film stub ... more details
In discussions of electric power generation deregulation , the term Stranded Costs represents the existing investments in infrastructure for the incumbent utility which may become redundant in a competitive environment. ref cite web title What s Stranded Cost? url http home.earthlink.net tpco stranded.html accessdate 2008 01 18 ref A large, incumbent monopoly electric power utility will have made substantial investments over the years and will carry debt. The market cost of electricity includes payments on this debt. As technology improves, the cost of generating electricity falls. A new entrant to the marketplace, unencumbered by debt, can build a modern plant and generate electricity at a lower cost than the incumbent. Logical customers leave the incumbent utility for the new entrant, reducing the utility s revenue, and spreading the debt payments across the fewer remaining customers. This is often caused by overly long depreciation schedules for large capital investments by utilities. The depreciation schedules were set presuming an ongoing monopoly. Solutions to the Stranded Costs problem include assigning a portion of the incumbent utility s debt to the new entrant as a condition of entry, or charging all customers in the market area a Stranded Cost Recovery Fee . In some cases, a government may assume a portion of an incumbent utility s debt and assign it to the public debt, thus freeing the utility to compete against new entrants unhindered. ref cite web title Chapter 4 Stranded Costs url http www.scc.virginia.gov caseinfo pue case streprt4.htm accessdate 2008 01 18 ref References Reflist 2 Category Electricity economics Category Electric power distribution de Stranded costs ... more details
Infobox Album See Wikipedia WikiProject Albums Name Stranded in Babylon Type Album Artist Larry Norman ... pure url yes Stranded In Babylon at Allmusic . ref ref name CR cite web url http www.crossrhythms.co.uk products Larry Norman Stranded In Babylon 5267 publisher CrossRhythms UK first Rupert last Loydell title Review Stranded in Babylon date 1 July, 1992 accessdate 2009 05 17 ref Automatically generated by DASHBot Stranded in Babylon is the title of an album recorded by Larry Norman in Norway in 1991. It was re released in 1993 as Stranded in Babylon The American Re Mix . ref Allmusic class album id r1313044 pure url yes Stranded In Babylon The American Re Mix at Allmusic . ref The album comprises ... produced. ref name CR History The creative rush that followed Norman s healing was expressed on Stranded ... Stranded in Babylon , Solid Rock Phydeaux Newsletter 1992 2. ref and overdubbing in Norway by the Albino ... version of Stranded in Babylon , an album which was recorded in Sweden in 1988. ref Robert Termorshuizen, Stranded In Babylon 1991 , http www.meetjesushere.com stranded in babylon.htm ref Hailed by both critics and fans as one of his best albums, ref See, for example, Jevon, Stranded in Babylon ..., Larry Norman Stranded In Babylon , CR Mag 11 1 July 1992 , http www.crossrhythms.co.uk products Larry Norman Stranded In Babylon 5267 ref by Norman and his brother, Charly, who share all of the musical duties. Stranded in Babylon was named Album of the Year by Christian rock journals. ref The Classic Larry Norman CD Releases , page 2, http www.larrynorman.uk.com store2.htm ref Stranded in Babylon ... Of The Second Trilogy 1988 , http www.meetjesushere.com Best Of Second.htm. However, on the Stranded ... God II ref Rupert Loydell, Larry Norman Stranded In Babylon , CR Mag 11 1 July 1992 , http www.crossrhythms.co.uk products Larry Norman Stranded In Babylon 5267 For a discussion of God Part II , see ..., Larry Norman Stranded In Babylon , CR Mag 11 1 July 1992 , http www.crossrhythms.co.uk products ... more details
FAIR USE of StrandedInSuburbia.jpg see image description page at http en.wikipedia.org wiki Image StrandedInSuburbia.jpg for rationale Unreferenced date November 2009 Infobox Album See Wikipedia WikiProject Albums Name Stranded in Suburbia Cover StrandedInSuburbia.jpg Type Album Artist Melissa McClelland Background orange Released 2004 Recorded Genre Pop Noir Length 54 54 Label Orange, Universal Producer Luke Doucet Reviews Last album Melissa McClelland album Melissa McClelland br 2001 This album Stranded in Suburbia br 2004 Next album Thumbelina s One Night Stand br 2006 Stranded in Suburbia is the title of Melissa McClelland s second album. The album was released in 2004 in Canada by the Orange Record Label. Track listing Good as Gold 4 55 White Lies Stranded in Suburbia 2 49 Pretty Blue 4 47 Jaded 3 51 Glimpse into Hell 3 18 Rooftop 5 11 Factory 2 39 Picture Postcard 3 39 Encinitas Rainstorm 4 41 Little Birds 4 26 Blue Farewell 5 55 Smoke Signals 4 45 Jaded Ogilve Fu Remix 4 00 The CD contains enhanced CD content interview clips, live performance footage, video clip of White Lies and more. All songs written by Melissa McClelland except Encinitas Rainstorm and Jaded , co written by Luke Doucet Factory written by Bruce Springsteen DEFAULTSORT Stranded In Suburbia Category 2004 albums Category Melissa McClelland albums 2000s pop album stub ... more details
multiple issues cleanup March 2011 copyedit March 2011 plot March 2011 Infobox film name Stranded image Stranded imp.jpg image size alt caption Theatrical release poster director Mar a Lid n producer Jos Mag n writer Juan Miguel Aguilera screenplay story narrator starring Vincent Gallo br Maria de Medeiros br Joaquim de Almeida br Maria Lid n br Daniel Aser br Johnny Ramone br Jos Sancho br Paul Gibert music Javier Navarrete cinematography editing Luis de la Madrid studio distributor Universal Studios Universal Pictures , Niggeman IndieFilms S.L released Film date 2002 04 12 Spain runtime 95 minutes country Spain language English br Spanish budget 6,230,811 810 million pesetas ref cite web url http www.hiperespacio.info Artics naufragos naufragos.htm title NAUFRAGOS En el espacio, nadie puede oir tus gritos. language Spanish trans title SHIPWRECKED In space, nobody can hear you scream. work Hiperespacio.info last Mayorga first Luis F. accessdate 2010 08 14 quote Se han invertido 810 millones ... especiales. ref gross preceded by followed by Stranded is a 2001 film about the fictional first ... StrandedStranded ref Plot plot date October 2011 The movie is set in 2020 and begins as the Ares ... of the impact and the other five crewmembers are stranded inside the toppled landing craft with no hope ... 26 months to send a rescue ship from Earth. However, the stranded landing crew have supplies for less ... for them to survive until the rescue ship from Earth arrives. Cast Image Stranded naufragos cast.jpg ... Cowboys filmmaking crew was used as a cost saving measure . Image Stranded AresSpacecraft landingSite70degLong ... . ref name imdb IMDb title id 0283015 StrandedStranded ref References reflist External links IMDb title 0283015 Stranded DEFAULTSORT Stranded Naufragos Category 2002 films Category English language ... adventure films Category Mars in film Category Films set in the 2020s es Stranded N ufragos fr Stranded film, 2002 ... more details
Stranded Brig is a painting by the American artist Edwin Dickinson 1891 1978 . Painted in oil paint oils on a canvas measuring 40 x 50 inches, it was created in 1934 for the federal government s first Depression era program for artists, the half year Public Works of Art Project . In October 1934 it entered the collection of the Museum of Fine Arts, Springfield, Massachusetts . History In February 1934, Dickinson was invited to participate in the Public Works of Art Project, which offered him weekly pay and an exhibition of the painting in Washington in May. He finished the work on time by reworking an abandoned painting, one of a small group done from imagination on a favorite subject, polar exploration, ref Ward, 2003, pp. 87 92. ref and changing its title to Stranded Brig . ref Ward, 2003, pp. 133 41. ref According to art historian John L. Ward, Dickinson s painting had begun life as Loss of the Tegethoff , the third painting of a series on the subject of the stranding of that ship in polar ice, left off after about 15 sittings in the fall of 1930. Ward points out that the size is the same, ref Ward, 2003, pp. 138, 239 note 47. ref that it represented boat, smoke, ice and rocks, and that the tally of sittings Dickinson reported putting in on the painting to date in a letter written 31 March 1934 about 40 does not match the number entered in his journals unless the about 15 sittings he had put in on the earlier painting are added in. ref Ward, 2003, p. 138. ref In the final version the ice has disappeared and upended rocks resembling those he had painted in The Glen are present ... 134. ref Analysis Adler s identification of the stranded ship with the artist, crushed by life s vicissitudes ... a back brace from June 1931 until after Stranded Brig was complete and on July 1, 1934 he entered ..., his reported comments about Stranded Brig , probably in the fall or winter of 1932, ref Ward, 2003 ... Paintings . Newark University of Delaware Press, 2003. ISBN 0 87413 783 7 DEFAULTSORT Stranded Brig ... more details
of people in Bangladesh known as stranded Pakistanis , he could not allow them to emigrate ... 1 hi world south asia 3003949.stm Vote for stranded Pakistanis BBC News 6 May, 2003 ref The ruling ... more details
Image Ti plasmid.svg thumb 350px right Ti plasmid with T DNA region The transfer DNA abbreviated T DNA is the transferred deoxyribonucleic acid DNA of the Ti plasmid tumor inducing Ti plasmid of some species ... from the fact that the bacterium transfers this DNA fragment into the host plant s cell nucleus nuclear DNA genome . The T DNA is bordered by 25 base pair repeats on each end. Transfer is initiated .... The bacterial T DNA is about 20,000 base pairs long and contains gene s that code for enzyme s synthesizing opines and phytohormone s. By transferring the T DNA into the plant genome, the bacterium ... are amino acid derivatives used by the bacterium as a source of carbon and energy. T DNA transformation Agrobacterium mediated T DNA transfer is widely used as a tool in biotechnology . In genetic engineering , the tumor promoting and opine synthesis genes are removed from the T DNA and replaced ... of glutamine synthetase . Agrobacterium is then used as a vector to transfer the engineered T DNA ... transgenic plant s carrying a foreign gene. Mechanism of T DNA Transformation The first step in integrating the T DNA into a host genome is the formation of nick at the right border of the Ti plasmid. This nick creates a region of singlestrandedDNA from the left border of the T DNA gene over to the right border which was cut. Singlestranded binding proteins then attach to the singlestrandedDNA. DNA synthesis will displace the singlestranded region and then a second nick at the left border region will release the singlestranded T DNA fragment. This fragment can then be incorporated into a host genome. T DNA mutagenesis The same procedure of T DNA transfer can be used to disrupt genes via insertional mutagenesis . Not only does the inserted T DNA sequence create a mutation but it also ..., ISBN 0 7167 1007 2 DEFAULTSORT T Dna Category Biotechnology Category Plant pathogens and diseases Category Mobile genetic elements biotech stub botany stub genetics stub fr ADN T pl T DNA sv T DNA ... more details
The DNA of one organism is labeled, then mixed with the unlabeled DNA to be compared against. The mixture is incubated to allow DNA strands to dissociate and reanneal, forming hybrid double strandedDNA ...about the specific use in genomics the general phenomenon Nucleic acid thermodynamics Hybridization DNADNA hybridization generally refers to a molecular biology technique that measures the degree of genetic similarity between pools of DNA sequences. It is usually used to determine the genetic distance between two species . When several species are compared that way, the similarity values allow the species to be arranged in a phylogenetic tree it is therefore one possible approach to carrying out molecular systematics . Charles Sibley and Jon Ahlquist , pioneers of the technique, used DNADNA hybridization to examine the phylogenetic relationships of avians the Sibley Ahlquist taxonomy and primates ... by DNADNA Hybridization author C.G. Sibley and J.E. Ahlquist journal Journal of Molecular ... DNA hybridization in the apes Technical issues ref DNA sequencing and computational comparisons ... DNADNA hybridization to study complex microbial ecosystems author S.S. Socransky, A.D. Haffajee ..., a process known as DNA melting . To assess the melting profile of the hybridized DNA, the double strandedDNA is bound to a column and the mixture is heated in small steps. At each step, the column is washed sequences that melt become singlestranded and wash off the column. The temperatures at which labeled DNA comes off the column reflects the amount of similarity between sequences and the self ... . Fundamentals of Molecular Evolution. a good text on these topics See also DNA melting Temperature gradient gel electrophoresis Category Molecular biology Category DNA fr Hybridation de l ADN it Ibridazione biologia molecolare hu DNS DNS hibridiz ci nl DNADNA hybridisatie ja DNADNA pt Hibridiza o de DNADNA sv DNADNA hybridisering tr DNADNA hibridizasyon ... more details
wiktionarypar singleSingle may refer to In music Single music , a song release Single Natasha Bedingfield song Single Natasha Bedingfield song Single New Kids on the Block and Ne Yo song Single New Kids on the Block and Ne Yo song Single coil , an electromagnetic guitar pickup type In sports Single baseball , the most common type of base hit Single cricket , point in cricket Single football , Canadian football point Single scull , a rowing boat propelled by a single rower with two oars In other fields Single , a slang term for a United States one dollar bill one dollar bill . Studio apartment Single , a single unit type of apartment dwelling also known as a studio Single , in Dublin and other parts of Ireland , a single portion of french fries chips , especially as part of the popular take away meal fish and chips . Glossary of bets offered by UK bookmakers Single bet , a type of bet made on one selection Single locomotive , a steam locomotive with a single pair of driving wheels Single cylinder engine , an engine with one piston Single person , a person who is not married usually refers today to someone who is neither married nor in a sexual relationship Single precision , a computer numbering format that occupies one storage location in computer memory at a given address See also Single ended disambiguation Singles disambiguation disambig da Single de Single es Solo fr Single it Singolo disambigua ko he nl Single ja pl Singel pt Singles simple Single sr Singl fi Sinkku sv Singel th uk ... more details
DNA gyrase , often referred to simply as gyrase , is an enzyme that relieves strain while double strandedDNA is being unwound by helicase . This causes negative supercoiling of the DNA. Bacteria l DNA ... , whose single circular DNA is cut by DNA gyrase and the two ends are then twisted around each .... DNA gyrase is a type II topoisomerase EC number 5.99.1.3 that introduces negative supercoil s or relaxes positive supercoils into DNA by looping the template so as to form a crossing, then cutting ... negative supercoils into DNA is what allows bacterial DNA to have free negative supercoils. The ability of gyrase to relax positive supercoils comes into play during DNA replication . The right handed nature of the DNA double helix causes positive supercoils to accumulate ahead of a translocating enzyme, in the case of DNA replication, a DNA polymerase . The ability of gyrase and topoisomerase IV ... that replication can continue. Mechanochemical model of gyrase activity A single molecule study ref ... pubmed docsum Mechanochemical Analysis of DNA Gyrase Using Rotor Bead Tracking , Nature 2006 Jan 5 Vol. 439 100 104. ref has characterized gyrase activity as a function of DNA tension applied force and Adenosine triphosphate ATP , and proposed a mechanochemical model. Upon binding to DNA the Gyrase DNA state , there is a competition between DNA wrapping and dissociation, where increasing DNA ... work by competitive inhibition of energy transduction of DNA gyrase by binding to the ATPase active ... bind these enzymes and prevent them from decatenating replicating DNA. Quinolone resistant bacteria frequently harbor mutated topoisomerases that resist quinolone binding. Notes reflist DNA ... carries out nicking of DNA,B subunit introduces negative supercoils,and then A subunit reseals the strands.Fluorquinolones .... References Molecular Cloning of Apicoplast Targeted Plasmodium falciparum DNA Gyrase Genes Unique ..., Mar. 2007, p.  398 412 Topoisomerases DNA replication Category DNA Category EC 5.99.1 Category ... more details
Unreferenced date December 2009 Single infobox Name A Single Cover Ed9595e8 a709 4ecc ac73 c24d89c2877c.jpg Artist The Cure from Album Pornography album Pornography Released July 12, 1982 Format Double Gramophone record 7 Gramophone record 7 Gramophone record 10 Recorded April 27, 1982 part 2 Genre Gothic rock Length 4 22 Label Fiction Records Producer Chris Parry producer Chris Parry br Phil Thornalley br The Cure Last single Charlotte Sometimes song Charlotte Sometimes br 1981 This single A Single br 1982 Next single Let s Go to Bed The Cure song Let s Go to Bed br 1982 A Single was the first limited edition release by The Cure . It was released as a gatefold double pack of 7 singles with a total of four tracks. It has also been released as a 10 record which contains all four songs from the double 7 pack, as well as a single 7 featuring only The Hanging Garden and Killing an Arab FICS 15 . Whilst the official name is A Single , this release is often referred to as The Hanging Garden as a way of avoiding confusion. The single made it to number 34 in the UK Singles Chart. Cover versions In 1998, the California based alternative rock band, AFI band AFI , covered The Hanging Garden , which was released on their A Fire Inside EP . Track listing Part one The Hanging Garden One Hundred Years Part two recorded April 27, 1982 at the Carling Apollo Manchester Manchester Apollo A Forest Live Killing an Arab Live Personnel Simon Gallup bass guitar bass , keyboard instrument keyboard Robert Smith musician Robert Smith guitar , keyboard, Singing vocals Lol Tolhurst Drum kit drums , keyboard TheCure DEFAULTSORT Single, A Category The Cure songs Category 1982 singles Category Songs written by Robert Smith es A single fr The Hanging Garden gl A Single pt A Single ... more details