Search: in
Non coding RNA
Non coding RNA in Encyclopedia Encyclopedia
  Tutorials     Encyclopedia     Videos     Books     Software     DVDs  
       
Encyclopedia results for Non coding RNA

Non coding RNA





Encyclopedia results for Non coding RNA

  1. Non-coding RNA

    A non coding RNA ncRNA is a functional RNA molecule that is not Translation genetics translated into a protein . Less frequently used synonyms are non protein coding RNA npcRNA , non messenger RNA nmRNA and functional RNA fRNA . The term small RNA sRNA is often used for short bacteria l ncRNAs. The DNA sequence from which a non coding RNA is transcribed is often called an RNA gene . Non coding RNA genes include highly abundant and functionally important RNAs such as transfer RNA tRNA and ribosomal ... ray analysis. The first non coding RNA to be characterised was an alanine tRNA found in baker s yeast ... by URNA in the early 1980s. Since then, the discovery of new non coding RNAs has continued with snoRNAs , Xist , CRISPR and many more. ref name Edd01 cite journal author Eddy SR title Non coding RNA ... RNA Long non coding RNAs in disease Long noncoding RNAs in disease As with protein s, mutations ..., Pickard MR, Hedge VL, Farzaneh F, Williams GT title GAS5, a non protein coding RNA, controls apoptosis .... Studies have suggested that p53 expression is subject to regulation by non coding RNA. ref ... 99 species of bacteria, archaea and eukaryota Nucleic acids DEFAULTSORT Non Coding Rna Category RNA Category Molecular genetics ca ARN no codificant cs Nek duj c RNA de Non coding RNA es ARN no codificante it RNA non codificante ja RNA pl Niekoduj ce RNA ru ur RNA ... Morris, KV editor year 2012 title Non coding RNAs and Epigenetic Regulation of Gene Expression Drivers ... Non coding RNAs hope or hype? journal Trends Genet volume 21 issue 5 pages 289 97 year 2005 pmid ... K title Stepwise chromatin remodelling by a cascade of transcription initiation of non coding ... S, Etkin LD title Potential structural role of non coding and coding RNAs in the organization of the cytoskeleton ... pmid 15944708 doi 10.1038 nature03702 bibcode 2005Natur.435..834L ref Long noncoding RNA Long non .... Yet the term fRNA could also include Messenger RNA mRNA as this is RNA coding for protein ...   more details



  1. Long non-coding RNA

    Long non coding RNA s long ncRNAs, lncRNA are in general considered somewhat arbitrarily as non protein ... 2007 , indicating at least four times more long non coding than coding RNA sequences. However ... author Goodrich JA, Kugel JF title Non coding RNA regulators of RNA polymerase II transcription journal ... al. title Identification of a novel non coding RNA, MIAT, that confers risk of myocardial infarction ... project identified 35,000 non coding transcripts from 10,000 distinct loci that bear many signatures ... transcripts from non coding transcripts. Genomic organization of long ncRNAs The current landscape ... shared within a number of different coding and non coding transcripts in the sense and antisense directions ... evolutionary change relative to the chimpanzee genome occurs mainly in non coding regions, many of which ... . Indeed, the transcription and expression of similar non coding ultraconserved elements was recently ... transcriptional programmes to regulate adjacent protein coding gene expression. The RNA binding protein ... of genes that escape from X inactivation might be mediated by expression of long non coding ... is also apparent in the rapid expression of non coding repetitive sequences. The short interspersed ... its antisense partner gene, CENPF CENP F in trans. Long non coding RNAs in post transcriptional ... mammals. Telomeric non coding RNAs Telomeres form the terminal region of mammalian chromosomes ... suggest an involvement for telomeric ncRNAs in various aspects of telomere biology. Long non coding ... disease conditions are found within non coding regions and the complex networks of non coding ... 2003 . Long intergenic non coding RNAs lincRNA Expand section more examples and references date December 2011 Intergenic refers to long non coding RNAs that are transcribed from non coding DNA sequences ... of a neuronal small non messenger RNA behavioural alterations in BC1 RNA deleted mice journal Behavioural ... reductase gene by a non coding interfering transcript journal Nature volume 445 issue 7128 pages ...   more details



  1. Listeria monocytogenes non-coding RNA

    RF01494 RF01494 . Category Listeriaceae Category Non coding RNA .... Many non coding RNAs have been identified within the bacteria genome where several of these have been classified as novel non coding RNAs and may contribute to pathogenesis . ref name pmid17259222 ... ref Tiling array s and mutagenesis identified many non coding RNAs within the L. monocytogenes genome and the location of these non coding RNAs within the bacterial genome was confirmed by Rapid Amplification ... of many non coding RNAs was dependent on the environment and that several of these non coding RNAs act as cis regulatory element s. Comparisons between previously characterized non coding RNAs and those present in the L. monocyotogenes genome identified 50 novel non coding RNAs in L. monocyotogenes . An additional comparative study between the pathogenic L. monocytogenes strain and the non pathogenic L. innocua strain identified several non coding RNAs that are only present within L ..., flanking gene s and also the characteristics of the novel small non coding RNAs identified and the previously characterized non coding RNAs present in L. monocytogenes Novel Non coding RNAs class ... in these studies EMBL accession AL591824.1 small Characterised non coding RNAs class wikitable ... BH title Identification of a sigma B dependent small noncoding RNA in Listeria monocytogenes. journal ... ykoY RF00080 T box leader T box RF00230 Glycine riboswitch glycine RF00504 6S SsrS RNA SsrS RF00013 ... ssrA RF00023 Ribosomal protein L13 leader L13 RF00555 Signal recognition particle RNA SRP RF00169 References ...   more details



  1. Conserved non-coding sequence

    A conserved non coding sequence CNS is a DNA sequence of noncoding DNA that is evolution arily Conserved sequence conserved . These sequences are of interest for their potential to gene regulation regulate gene production . ref name Hardison Cite journal last1 Hardison first1 RC. title Conserved noncoding sequences are reliable guides to regulatory elements. journal Trends Genet volume 16 issue 9 pages 369 72 month Sep year 2000 doi PMID 10973062 url http www.euchromatin.org Hardison1.htm ref CNSs in plants ref name Freeling Cite journal last1 Freeling first1 M last2 Subramaniam first2 S title ... cis acting regulatory elements . Conserved non coding sequences can be important sites of evolutionary ... domestica reveals innovation in non coding sequences. journal Nature year 2007 pages 167 177 volume ... by LINE machinery of unrelated RNA transcripts gives rise to non functional processed pseudogenes ... first1 M. last2 Sumiyama first2 K. last3 Saitou first3 N. title Evolution of Conserved Non Coding ... first1 M. last2 Sumiyama first2 K. last3 Saitou first3 N. title Evolution of Conserved Non Coding ... functions commonly associated with conserved non coding regions are thought to play a role in the evolution ... of sequence found mostly in eukaryotic organisms which interrupt the coding regions of genes, with basepair ... Transcription genetics RNA transcripts , rather than in the introns. This suggests an important ... be used to develop highly specific medicines that target RNA transcripts. ref name Jegga Cite journal ... interspersed nuclear elements SINEs . In LTR retrotransposons, after the RNA template is degraded, a DNA ... rna splicing splicing patterns . A particular transposed element will be positively selected for if the altered ... is so much stronger than the selection in protein coding regions ref name Bejerano Cite ... name Lockton Cite journal last1 Lockton first1 Steven. last2 Gaut first2 BS. title Plant conserved non coding sequences and paralogue evolution. journal Trends in Genetics volume 21 issue 1 pages 60 65 ...   more details



  1. Aspergillus fumigatus non-coding RNAs

    Category Aspergillus Category Non coding RNA ... in A. fumigatus . Non Coding RNAs present in A. fumigatus class wikitable Name Size Genome Location Target Type Accession number U1 spliceosomal RNA U1 1 132 Intergenic Afu1g06980 Afu1g07000 snRNA AM921915 U1 spliceosomal RNA U1 2 132 Intergenic Afu4g12490 Afu4g12500 snRNA AM921916 U5 spliceosomal RNA U5 99 Intergenic Afu6g12670 Afu6g12680 snRNA AM921917 U6 spliceosomal RNA U6 50 Intergenic Afu4g12500 ... novel AM921946 Afu 202 266 Intergenic Afu1g10420 Afu1g10430 Signal recognition particle RNA SRP RNA ...   more details



  1. DNA/RNA non-specific endonuclease

    Orphan date August 2011 Infobox protein family Symbol Endonuclease NS Name Endonuclease NS image PDB 1smn EBI.jpg width caption identification of the serratia endonuclease dimer structural basis and implications for catalysis Pfam PF01223 Pfam clan CL0263 InterPro IPR001604 SMART PROSITE PDOC00821 MEROPS SCOP 1smn TCDB OPM family OPM protein CAZy CDD In molecular biology, enzymes in the DNA RNA non specific endonuclease family of bacteria l and eukaryotic endonucleases EC number 3.1.30. share the following characteristics they act on both DNA and RNA , bond cleavage cleave double stranded and single stranded nucleic acid s and require a divalent ion such as magnesium for their activity. A histidine has been shown to be essential for the activity of the Serratia marcescens nuclease . This residue chemistry residue is located in a conserved sequence conserved region which also contains an aspartic acid residue that could be implicated in the binding of the divalent ion. ref name pmid8078761 cite journal author Friedhoff P, Gimadutdinow O, Pingoud A title Identification of catalytically relevant amino acids of the extracellular Serratia marcescens endonuclease by alignment guided mutagenesis journal Nucleic Acids Res. volume 22 issue 16 pages 3280 7 year 1994 month August pmid 8078761 pmc 523719 doi 10.1093 nar 22.16.3280 url ref References reflist InterPro content IPR001604 Category Protein domains ...   more details



  1. Small non-coding RNAs in the endosymbiotic diazotroph ?-proteobacterium Sinorhizobium meliloti

    . rect 0 0 650 80 r7 RNA Smr7C rect 0 120 650 200 r9 RNA Smr9C rect 0 240 650 320 r14 RNA Smr14C2 rect 0 360 650 440 r15 RNA Smr15C1 & Smr15C2 rect 0 480 650 560 http rfam.sanger.ac.uk family 6S Smr22C rect 0 600 650 680 r35 RNA Smr35B rect 0 720 650 800 r45 RNA Smr45C imagemap Genome Post genomic research has rendered bacterial small non coding RNAs sRNAs as major players in post transcriptional ... title Identification of differentially expressed small non coding RNAs in the legume endosymbiont Sinorhizobium ... author Majdalani N, Vanderpool CK, Gottesman S title Bacterial small RNA regulators journal Crit Rev .... Discovery Two complementary computational screens, List of RNA structure prediction software eQRNA and RNAz , were used to search for novel Small RNA sRNA encoding genes in the intergenic regions ... transcripts. These new genomic loci were referred to as smr , for S. meliloti RNA. Seven of the Smr ... strand. ref rowspan 2 r7 RNA Smr7C rowspan 2 r7 RNA r7 rowspan 2 Sra03 Sm13 SmelC023 rowspan ... 3 rowspan 2 r9 RNA Smr9C rowspan 2 r9 RNA r9 rowspan 2 Sra32 Sm10 SmelC289 ... 3 5 CCGGAAACGGATTAAAGATCACGCG 3 rowspan 2 r14 RNA Smr14C2 rowspan 2 r14 RNA r14 ... 2 SMc02051 tig 5 TGCTTGATCTGATTGGCAACCGGGA 3 5 TCCCGGTTGCCAATCAGATCAAGCA 3 rowspan 2 r15 RNA Smr15C1 rowspan 2 r15 RNA r15 rowspan 2 Sra41 Sm3 SmelC411 rowspan 2 AM939560 rowspan 2 1698731 rowspan ... 3 rowspan 2 r15 RNA Smr15C2 rowspan 2 r15 RNA r15 rowspan 2 Sra41 Sm3 SmelC412 rowspan ... r35 RNA Smr35B rowspan 2 r35 RNA r35 rowspan 2 SmB6 SmelC053 rowspan 2 AM939563 rowspan 2 577730 ... 3 rowspan 2 r45 RNA Smr45C rowspan 2 r45 RNA r45 rowspan 2 SmelC706 rowspan 2 AM939562 ... Category RNA ...   more details



  1. Coding

    wiktionary coding Coding may refer to Channel coding in coding theory Line coding Computer programming , the process of designing, writing, testing, debugging troubleshooting, and maintaining the source code of computer programs The process of Statistical classification of information Coding social sciences , refers to an analytical process in which data, in both quantitative form such as questionnaires results or qualitative such as interview transcripts are categorised to facilitate analysis Coding therapy , a controversial therapy used to treat addictions Legal coding , the process of creating summary or keyword data from a document. It is widely used in the legal profession to create a fast search index or database of documents for use in litigation A coding strand of DNA is translated into a protein product Present progressive tense for Code Blue emergency code Code Blue , which is a patient in Cardiac Arrest or Respiratory Arrest See also Code , a rule for converting a piece of information for example, a letter, word, phrase, or gesture into another form or representation one sign into another sign , not necessarily of the same type Entropy encoding , a lossless data compression scheme that is independent of the specific characteristics of the medium Source coding Medical coding disambiguation ...   more details



  1. RNA

    00045BB6 5D49 1150 902F83414B7F4945 ref . These so called non coding RNA s ncRNA can be encoded ... prominent examples of non coding RNAs are transfer RNA tRNA and ribosomal RNA rRNA , both of which ... Like DNA, most biologically active RNAs, including mRNA , tRNA , rRNA , snRNA s, and other non coding ... for protein however about 97 of the transcriptional output is non protein coding in eukaryotes ... JS title Challenging the dogma the hidden layer of non protein coding RNAs in complex organisms ... year 2002 isbn 0 7167 4684 0 oclc 179705944 48055706 59502128 ref There are also non coding RNAs ... mRNA has been transcribed from DNA, it is processed to mature mRNA. This removes its intron s non coding ... en ra b .nju kle . k s d , or RNA , is one of the three major macromolecule s along with DNA and protein s essential for all known forms of life . Like DNA, RNA is made up of a long chain of components ... group. The sequence of nucleotides allows RNA to encode genetic information. All cellular organisms use messenger RNA mRNA to carry the genetic information that directs the synthesis of proteins. In addition, many virus es use RNA instead of DNA as their genetic material. Some RNA molecules play ... on ribosome s. This process uses transfer RNA tRNA molecules to deliver amino acids to the ribosome, where ribosomal RNA rRNA links amino acids together to form proteins. The chemical structure of RNA is very similar to that of DNA, with two differences a RNA contains the sugar ribose , while DNA contains ... RNA has the nucleobase uracil while DNA contains thymine . Unlike DNA, most RNA molecules are single ... of the ribosome 3CC2.png thumb Three dimensional representation of the 50S ribosomal subunit. RNA is in ochre, protein in blue. The active site is in the middle red . RNA and DNA are both nucleic acid s, but differ in three main ways Unlike double stranded DNA, RNA is a single stranded molecule ... , RNA contains ribose in deoxyribose there is no hydroxyl group attached to the pentose ring ...   more details



  1. Coding strand

    When referring to Transcription genetics DNA transcription , the coding strand is the DNA strand which has the same Nucleobase base sequence as the RNA transcript produced although with thymine replaced by uracil . It is this strand which contains codons , while the non coding strand contains anti codons. Alternative terms for strands Wherever a gene exists on a DNA molecule , one strand is the coding strand or sense strand or non template strand , and the other is the noncoding strand also called the antisense strand antisense is a general term for a sequence of DNA or RNA that is complementary to mRNA http books.google.com books?id BrNpbPkzoxAC&pg PA129&lpg PA129&dq coding strand antisense&source web&ots t6yUAob0Km&sig O3UVL8ZYlFi0ljVYax8hp695sRo PPA75,M1 , anticoding strand, template strand, or transcribed strand . Strands in transcription bubble During Transcription genetics transcription , RNA polymerase unwinds a short section of the DNA double helix near the start of the gene. This unwound section is known as the transcription bubble . The RNA polymerase, and therefore the transcription bubble, travels along the noncoding strand in the opposite, 3 to 5 , direction, as well as polymerizing a newly synthesized strand in 5 to 3 or Upstream and downstream DNA downstream direction. The DNA double helix is rewound by RNA polymerase at the rear of the transcription bubble Lewin, pp 235 http books.google.com books?id BrNpbPkzoxAC&pg PA129&lpg PA129&dq coding strand antisense&source web&ots t6yUAob0Km&sig O3UVL8ZYlFi0ljVYax8hp695sRo PPA75,M1 . Like how a zipper works, only it unzips it and rezips it without going back and forth. RNA DNA hybrid Where the helix is unwound, the coding strand consists of unpaired bases, whilst the template strand consists of an RNA DNA composite ... nucleotides of the RNA transcript, complementary base paired to the template strand. The number ... York, USA. http books.google.com books?id BrNpbPkzoxAC&pg PA129&lpg PA129&dq coding strand antisense&source ...   more details



  1. C0719 RNA

    Infobox rfam Name C0719 RNA image RF00117.jpg width caption Predicted secondary structure and sequence conservation of C0719 Symbol C0719 AltSymbols Rfam RF00117 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The C0719 RNA is a bacterial non coding RNA of 222 nucleotides in length that is found between the yghK and glcB gene s in the genomes of Escherichia coli and Shigella flexneri . This non coding RNA was originally identified in E.coli using microarray high density oligonucleotide probe arrays microarray. ref name pmid12202758 cite journal author Tjaden B, Saxena RM, Stolyar S, Haynor DR, Kolker E, Rosenow C title Transcriptome analysis of Escherichia coli using high density oligonucleotide probe arrays journal Nucleic Acids Res. volume 30 issue 17 pages 3732 8 year 2002 pmid 12202758 doi 10.1093 nar gkf505 pmc 137427 ref The function of this ncRNA is unknown. See also C0299 RNA C0343 RNA C0465 RNA References references External links Rfam id RF00117 name C0719 RNA DEFAULTSORT C0719 Rna Category Non coding RNA molecular cell biology stub ...   more details



  1. RydB RNA

    Infobox rfam Name rydB RNA image RF00118.jpg width caption Predicted secondary structure and sequence conservation of rydB Symbol rydB AltSymbols Rfam RF00118 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The RydB RNA is a non coding RNA originally identified in E. coli in an RNA screen. ref name Was01 cite journal last Wassarman first KM coauthors Repoila F, Rosenow C, Storz G, Gottesman S year 2001 title Identification of novel small RNAs using comparative genomics and microarrays journal Genes Dev volume 15 pages 1637&ndash 1651 pmid 11445539 doi 10.1101 gad.901001 issue 13 pmc 312727 ref This gene is only 67 nucleotide s in length and is composed of a stem loop hairpin like structure. RydB lies between the ydiC and ydiH in E. coli . Homologous RNA genes have been found in other species such as Shigella flexneri and Salmonella species. The molecular function of this RNA is unknown. ref name Was01 See also RyhB RNA RyeB RNA RyeE RNA References reflist 1 External links Rfam id RF00118 name rydB RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. RyeB RNA

    Infobox rfam Name RyeB RNA image RF00111.jpg width caption Predicted secondary structure and sequence conservation of RyeB Symbol RyeB AltSymbols Rfam RF00111 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The RyeB RNA is a non coding RNA that was identified in a large scale screen of E. coli . ref cite journal last Wassarman first KM coauthors Repoila F, Rosenow C, Storz G, Gottesman S year 2001 title Identification of novel small RNAs using comparative genomics and microarrays journal Genes Dev volume 15 pages 1637&ndash 1651 pmid 11445539 doi 10.1101 gad.901001 issue 13 pmc 312727 ref The exact 5 and 3 ends of this RNA are uncertain. This RNA overlaps the SraC RyeA RNA on the opposite strand suggesting that the two may act in a concerted manner. See also RydB RNA RyhB RNA RyeE RNA References reflist 1 External links Rfam id RF00111 name RyeB RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. RNA-OUT

    Orphan date February 2009 Infobox rfam Name RNA OUT image RF00240.jpg width caption Predicted secondary structure and sequence conservation of RNA OUT Symbol RNA OUT AltSymbols Rfam RF00240 miRBase miRBase family RNA type Gene Antisense RNA antisense Tax domain Bacteria GO SO SO 0000644 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData RNA OUT is a non coding RNA that is antisense to the RNA IN non coding RNA. Transposable element Transposition of insertion sequence IS10 is regulated by an anti sense RNA which inhibits transposase expression when IS10 is present in multiple copies per cell. RNA OUT consists of a stem loop domain topped by a flexibly paired loop the 5 end of the target molecule, RNA IN, is complementary to the top of the loop, and complementarity extends for 35 nucleotides down one side of RNA OUT. ref cite journal last Kittle first JD coauthors Simons RW, Lee J, Kleckner N year 1989 title Insertion sequence IS10 anti sense pairing initiates by an interaction between the 5 end of the target RNA and a loop in the anti sense RNA journal J Mol Biol volume 210 pages 561&ndash 572 pmid 2482367 doi 10.1016 0022 2836 89 90132 0 issue 3 ref References reflist 1 External links Rfam id RF00240 name RNA OUT Category Non coding RNA molecular cell biology stub ...   more details



  1. IS102 RNA

    Infobox rfam Name IS102 RNA image RF00124.jpg width caption Predicted secondary structure and sequence conservation of IS102 Symbol IS102 AltSymbols Rfam RF00124 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The IS102 RNA is a non coding RNA that is found in bacteria such as Shigella flexneri and Escherichia coli . The RNA is 208 nucleotide s in length and found between the yeeP and flu genes . This RNA was identified in a computational screen of E. coli . ref cite journal last Tjaden first B coauthors Saxena RM, Stolyar S, Haynor DR, Kolker E, Rosenow C year 2002 title Transcriptome analysis of Escherichia coli using high density oligonucleotide probe arrays journal Nucleic Acids Res volume 30 pages 3732&ndash 3738 pmid 12202758 doi 10.1093 nar gkf505 issue 17 pmc 137427 ref The function of this RNA is unknown. See also IS061 RNA IS128 RNA References reflist 1 External links Rfam id RF00124 name IS102 RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. IS128 RNA

    Infobox rfam Name IS128 RNA image RF00125.jpg width caption Predicted secondary structure and sequence conservation of IS128 Symbol IS128 AltSymbols Rfam RF00125 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0001263 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The IS128 RNA is a non coding RNA found in bacteria such as Escherichia coli and Shigella flexneri . The RNA is 209 nucleotides in length. It is found between the sseA and sseB genes . The IS128 RNA was initially identified in a computational screen of the E. coli genome. ref cite journal last Tjaden first B coauthors Saxena RM, Stolyar S, Haynor DR, Kolker E, Rosenow C year 2002 title Transcriptome analysis of Escherichia coli using high density oligonucleotide probe arrays journal Nucleic Acids Res volume 30 pages 3732&ndash 3738 pmid 12202758 doi 10.1093 nar gkf505 issue 17 pmc 137427 ref The function of this RNA is unknown. See also IS061 RNA IS102 RNA References reflist 1 External links Rfam id RF00125 name IS128 RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. RydC RNA

    Infobox rfam Name RydC RNA image RF00505.jpg width caption Predicted secondary structure and sequence conservation of RydC Symbol RydC AltSymbols Rfam RF00505 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData RydC is a bacteria l non coding RNA . RydC is thought to regulate a messenger RNA mRNA , yejABEF , which encodes an ABC transporter protein . RydC is known to bind the Hfq protein , which causes a conformational change in the RNA molecule. The Hfq RydC complex is then thought to bind to the target mRNA and induce its degradation. ref name antal 2005 cite journal last Antal first M coauthors Bordeau V, Douchin V, Felden B year 2005 title A small bacterial RNA regulates a putative ABC transporter journal J Biol Chem. volume 280 pages 7901&ndash 7908 pmid 15618228 doi 10.1074 jbc.M413071200 issue 9 ref See also RyfA RNA RydB RNA RybB RNA References reflist 1 External links Rfam id RF00505 name RydC RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. C0465 RNA

    Infobox rfam Name C0465 RNA image RF00116.jpg width caption Predicted secondary structure and sequence conservation of C0465 Symbol C0465 AltSymbols Rfam RF00116 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The C0465 RNA is a bacterial non coding RNA of 78 nucleotides in length that is found between the tar and cheW gene s in the genomes of Escherichia coli and Shigella flexneri . This ncRNA was originally identified in E.coli using microarray high density oligonucleotide probe arrays microarray ref name pmid12202758 cite journal author Tjaden B, Saxena RM, Stolyar S, Haynor DR, Kolker E, Rosenow C title Transcriptome analysis of Escherichia coli using high density oligonucleotide probe arrays journal Nucleic Acids Res. volume 30 issue 17 pages 3732 8 year 2002 pmid 12202758 doi 10.1093 nar gkf505 pmc 137427 ref . The function of this ncRNA is unknown. See also C0299 RNA C0343 RNA C0719 RNA References references External links Rfam id RF00116 name C0465 RNA DEFAULTSORT C0465 Rna Category Non coding RNA molecular cell biology stub ...   more details



  1. HgcF RNA

    Infobox rfam Name HgcF RNA image RF00058.jpg width caption Predicted secondary structure and sequence conservation of HgcF Symbol HgcF AltSymbols Rfam RF00058 miRBase miRBase family RNA type Gene Tax domain Archaea GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The HgcF RNA gene is a non coding RNA identified computationally and experimentally verified in AT rich hyperthermophiles. ref cite journal last Klein first RJ coauthors Misulovin Z, Eddy SR year 2002 title Noncoding RNA genes identified in AT rich hyperthermophiles journal Proc Natl Acad Sci USA volume 99 pages 7542&ndash 7547 pmid 12032319 doi 10.1073 pnas.112063799 issue 11 pmc 124278 ref The genes were named hgcA through hgcG high GC . The molecular function of HgcF is unknown. See also HgcC family RNA HgcE RNA HgcG RNA SscA RNA References reflist 1 External links Rfam id RF00058 name HgcF RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. IS061 RNA

    Infobox rfam Name IS061 RNA image RF00115.jpg width caption Predicted secondary structure and sequence conservation of IS061 Symbol IS061 AltSymbols Rfam RF00115 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0001263 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The ISO61 RNA is a bacterial non coding RNA of 181 nucleotides in length that is found between the abgR and ydaL genes in Escherichia coli and Shigella flexneri . It was discovered using a computational screen of the E. coli genome . ref cite journal last Chen first S coauthors Lesnik EA, Hall TA, Sampath R, Griffey RH, Ecker DJ, Blyn LB year 2002 title A bioinformatics based approach to discover small RNA genes in the Escherichia coli genome journal Biosystems volume 65 pages 157&ndash 177 pmid 12069726 doi 10.1016 S0303 2647 02 00013 8 issue 2 3 ref The function of this RNA is unknown. See also IS102 RNA IS128 RNA References reflist 1 External links Rfam id RF00115 name IS061 RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. Coding region

    The coding region of a gene , also known as the coding sequence or CDS , is that portion of a gene s DNA or RNA , composed of exon s, that codes for protein. The region is bounded nearer the Directionality molecular biology 5 end 5 end by a start codon and nearer the Directionality molecular biology 3 end 3 end with a stop codon . The coding region in mRNA is bounded by the five prime untranslated region and the three prime untranslated region , which are also parts of the exons. ref cite web last Twyman first Richard title Gene Structure publisher The Wellcome Trust date 1 August 2003 url http genome.wellcome.ac.uk doc WTD020755.html accessdate 6 April 2003 ref The coding region of an organism is sum total of the organism s genome that is composed of gene coding regions. ref Cite book last Goto et al. first Mami title Analysis of CpG Dinucleotide Frequency in Bacterial Genomes with Respect to Genomic Regions and Codon publisher The Fourth Annual International Conference on Computational Molecular Biology, Tokyo, Japan date April 8, 2000 url http recomb2000.ims.u tokyo.ac.jp Posters pdf 112.pdf accessdate 6 April 2009 ref Coding sequence annotation While identification of open reading frames within a DNA sequence is straightforward, identifying coding sequences is not, because the cell translates only a subset of all open reading frames to proteins. ref Cite journal last1 Furuno first1 Masaaki last2 Kasukawa first2 Takeya last3 Saito first3 Rintaro last4 Adachi first4 Jun last5 Suzuki first5 Harukazu last6 Baldarelli first6 Richard last7 Hayashizaki first7 Yoshihide last8 Okazaki first8 Yasushi title CDS Annotation in Full Length cDNA Sequence journal Genome Research volume 21 issue 9 pages 1478 1487 publisher Cold Spring Harbor Laboratory Press date September 2011 year 2011 url http genome.cshlp.org content 13 6b 1478.full.pdf html doi 10.1101 gr.1060303 accessdate 18 ... functional elements such as RNA genes and regulatory sequences. See also Open reading frame Gene ...   more details



  1. HgcG RNA

    Infobox rfam Name HgcG RNA image RF00064.jpg width caption Predicted secondary structure and sequence conservation of HgcG Symbol HgcG AltSymbols Rfam RF00064 miRBase miRBase family RNA type Gene Tax domain Archaea GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The HgcG RNA gene is a non coding RNA that was identified bioinformatics computationally and experimentally verified in AT rich hyperthermophile s. ref cite journal last Klein first RJ coauthors Misulovin Z, Eddy SR year 2002 title Noncoding RNA genes identified in AT rich hyperthermophiles journal Proc Natl Acad Sci USA volume 99 pages 7542&ndash 7547 pmid 12032319 doi 10.1073 pnas.112063799 issue 11 pmc 124278 ref The genes from this screen were named hgcA through hgcG high GC . HgcG is of unknown function. hgcG is significantly similar to a region of the Archaeoglobus Archaeoglobus fulgidus genome. See also HgcC family RNA HgcE RNA HgcF RNA References reflist 1 External links Rfam id RF00064 name HgcG RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. RyeE RNA

    Infobox rfam Name CyaR Rye RNA image RF00112.jpg width caption Predicted secondary structure and sequence conservation of CyaR RyeE Symbol CyaR RyeE AltSymbols RyeE Rfam RF00112 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The CyaR RNA formerly known as RyeE RNA non coding RNA was identified in a large scale screen of E. coli and was called candidate 14. ref cite journal last Wassarman first KM coauthors Repoila F, Rosenow C, Storz G, Gottesman S year 2001 title Identification of novel small RNAs using comparative genomics and microarrays journal Genes Dev volume 15 pages 1637&ndash 1651 pmid 11445539 doi 10.1101 gad.901001 issue 13 pmc 312727 ref The exact 5 and 3 ends of this RNA are uncertain. This gene lies between yegQ and orgK in E. coli . This small RNA was shown to be bound by the Hfq protein . This RNA has been renamed as CyaR for cyclic AMP activated RNA . It has recently been shown that CyaR RNA acts as a repressor of the porin OmpX. ref name pmid18399940 cite journal author Papenfort K, Pfeiffer V, Lucchini S, Sonawane A, Hinton JC, Vogel J title Systematic deletion of Salmonella small RNA genes identifies CyaR, a conserved CRP dependent riboregulator of OmpX synthesis journal Mol. Microbiol. volume 68 issue 4 pages 890 906 year 2008 month May pmid 18399940 doi 10.1111 j.1365 2958.2008.06189.x url ref It has also been shown that cyaR expression is tightly controlled by the cyclic AMP receptor protein, CRP . ref name pmid18399940 See also RydB RNA RyhB RNA RyeB RNA References reflist 1 External links Rfam id RF00112 name RyeE RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. Elias coding

    Elias coding is term used for one of two types of lossless coding schemes used in digital communications Shannon Fano Elias coding , a precursor to arithmetic coding , in which probabilities are used to determine codewords Universal code data compression Universal coding using one of Elias three universal codes, each with predetermined codewords Elias delta coding Elias gamma coding Elias omega coding Disambig cs Eliasovy k dy ...   more details



  1. SroD RNA

    Infobox rfam Name sroD RNA image RF00370.jpg width caption Predicted secondary structure and sequence conservation of sroD Symbol sroD AltSymbols Rfam RF00370 miRBase miRBase family RNA type Gene Bacterial small RNA sRNA Tax domain Bacteria GO SO SO 0000655 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The bacterial sroD RNA gene is a non coding RNA of 90 nucleotides in length. sroD is found in several Enterobacterial species but its function is unknown. ref name Vog03 cite journal last Vogel first J coauthors Bartels V, Tang TH, Churakov G, Slagter Jager JG, Huttenhofer A, Wagner EG year 2003 title RNomics in Escherichia coli detects new sRNA species and indicates parallel transcriptional output in bacteria journal Nucleic Acids Res volume 31 pages 6435&ndash 6443 pmid 14602901 doi 10.1093 nar gkg867 issue 22 pmc 275561 ref SroE RNA SroE and SroH RNA SroH were identified in the same bioinformatics search. ref name Vog03 References reflist 1 External links Rfam id RF00370 name sroD RNA Category Non coding RNA molecular cell biology stub ...   more details




Articles 1 - 25 of 357929          Next


Search   in  
Search for Non coding RNA in Tutorials
Search for Non coding RNA in Encyclopedia
Search for Non coding RNA in Videos
Search for Non coding RNA in Books
Search for Non coding RNA in Software
Search for Non coding RNA in DVDs
Search for Non coding RNA in Store


Advertisement




Non coding RNA in Encyclopedia
Non coding RNA top Non coding RNA
Home - Add TutorGig to Your Site - Disclaimer

©2011-2013 TutorGig.info All Rights Reserved. Privacy Statement