Search: in
Pyrococcus furiosus
Pyrococcus furiosus in Encyclopedia Encyclopedia
  Tutorials     Encyclopedia     Videos     Books     Software     DVDs  
       
Encyclopedia results for Pyrococcus furiosus

Pyrococcus furiosus





Encyclopedia results for Pyrococcus furiosus

  1. Piwi

    Infobox protein family Symbol Piwi Name Piwi domain image PDB 1z26 EBI.jpg width caption Structure of the Pyrococcus furiosus Argonaute protein. ref name pmid15800637 cite journal author Rivas FV, Tolia NH, Song JJ, et al. title Purified Argonaute2 and an siRNA form recombinant human RISC journal Nat. Struct. Mol. Biol. volume 12 issue 4 pages 340 9 year 2005 month April pmid 15800637 doi 10.1038 nsmb918 url ref Pfam PF02171 Pfam clan InterPro IPR003165 SMART PROSITE PS50822 MEROPS SCOP TCDB OPM family OPM protein CDD cd02826 PDB PDB2 1u04 , PDB2 1w9h , PDB2 1ytu , PDB2 1yvu , PDB2 1z25 , PDB2 1z26 , PDB2 2bgg , PDB2 2f8s , PDB2 2f8t , PDB2 2nub , PDB2 2w42 Image 1ytu argonaute dsrna.png thumb right The piwi domain of an argonaute protein with bound siRNA , components of the RNA induced silencing complex that mediates gene silencing by RNA interference . The piwi sometimes also PIWI originally P element induced wimpy testis in Drosophila ref name Saito Saito K, Nishida KM, Mori T, Kawamura Y, Miyoshi K, Nagami T, Siomi H, Siomi MC. 2006 . Specific association of Piwi with rasiRNAs derived from retrotransposon and heterochromatic regions in the Drosophila genome. Genes Dev 20 16 2214 22. PMID 16882972 ref class of gene s was originally identified as encoding gene regulation regulatory protein s responsible for maintaining incomplete cell differentiation differentiation in stem cell s and maintaining the stability of cell division rates in germ line cells. ref name Cox Cox DN, Chao A, Lin H. 2000 . piwi encodes a nucleoplasmic factor whose activity modulates the number and division rate of germline stem cells. Development 127 3 503 14. PMID 10631171 ref Piwi proteins are highly conservation genetics conserved across evolution ary lineages and are present in both plants and animals. ref name Cox2 Cox DN, Chao A, Baker J, Chang L, Qiao D, Lin H. 1998 . A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self renewal. Genes Dev 12 23 ...   more details



  1. Mannose phosphate isomerase

    Mechanics Study on the Rversible Isomerization of Glucose and Fructose Catalyzed by Pyrococcus furiosus ...   more details



  1. 3-dehydroquinate synthase

    Pyrococcus furiosus journal Enzyme Res volume 2011 issue pages 134893 year 2011 pmid 21603259 pmc ...   more details



  1. ADP-specific glucokinase

    enzyme Name ADP specific glucokinase EC number 2.7.1.147 CAS number 173585 07 4 IUBMB EC number 2 7 1 147 GO code 0043843 image width caption PBB geneid 83440 In enzymology , an ADP specific glucokinase EC number 2.7.1.147 also known as ADP dependent glucokinase is an enzyme that catalysis catalyzes the chemical reaction ADP D glucose math rightleftharpoons math AMP D glucose 6 phosphate Thus, the two substrate biochemistry substrates of this enzyme are adenosine diphosphate ADP and D glucose , whereas its two product chemistry products are adenosine monophosphate AMP and D glucose 6 phosphate . This enzyme belongs to the family of transferase s, to be specific those transferring phosphorus containing groups phosphotransferase s with an alcohol group as acceptor. In humans, the ADP dependent glucokinase is encoded by the ADPGK gene . ref name pmid14975750 cite journal author Ronimus RS, Morgan HW title Cloning and biochemical characterization of a novel mouse ADP dependent glucokinase journal Biochem. Biophys. Res. Commun. volume 315 issue 3 pages 652 8 year 2004 month March pmid 14975750 doi 10.1016 j.bbrc.2004.01.103 url ref Structural studies As of late 2007, only one tertiary structure structure has been solved for this class of enzymes, with the Protein Data Bank PDB accession code PDB link 1GC5 . References reflist Further reading refbegin 2 cite journal author Kengen SW, Tuininga JE, de Bok FA, Stams AJ, de Vos WM year 1995 title Purification and characterization of a novel ADP dependent glucokinase from the hyperthermophilic archaeon Pyrococcus furiosus journal J. Biol. Chem. volume 270 pages 30453&ndash 7 pmid 8530474 doi 10.1074 jbc.270.51.30453 issue 51 cite journal author Gerhard DS title The Status, Quality, and Expansion of the NIH Full Length cDNA Project The Mammalian Gene Collection MGC journal Genome Res. volume 14 issue 10B pages 2121 7 year 2004 pmid 15489334 doi 10.1101 gr.2596504 pmc 528928 author separator , author2 Wagner L author3 Feingold E ...   more details



  1. Living Interplanetary Flight Experiment

    atmosphere. M. wolfeii is a methane producing organism. Pyrococcus furiosus P. furiosus ...   more details



  1. List of sequenced archaeal genomes

    nuccore NC 000868 NC 000868 NCBI Reference Sequence Pyrococcus Pyrococcus furiosus furiosus DSM 3638 1,908,256 2,065 ref cite journal first1 Dennis L. last1 Maeder first2 Robert B. last2 ... archaea Pyrococcus furiosus and P. horikoshii inferred from complete genomic sequences pmid 10430560 ... Strain biology Strain base pair Base Pair s Gene s Reference GenBank identifier Pyrococcus Pyrococcus ... guide small nucleolar RNAs lessons from the Pyrococcus genomes journal Journal of Molecular Biology ... cgi pmidlookup?view long&pmid 10430560 ref http www.ncbi.nlm.nih.gov nuccore AE009950 AE009950 Pyrococcus Pyrococcus horikoshii horikoshii OT3 1,738,505 2,061 ref cite journal last1 Kawarabayasi first1 ... and Gene Organization of the Genome of a Hyper thermophilic Archaebacterium, Pyrococcus horikoshii ... 5.2.55 ref http www.ncbi.nlm.nih.gov nuccore NC 000961 NC 000961 NCBI Reference Sequence Pyrococcus sp. NA2 1,861,000 ref name GOLD http www.ncbi.nlm.nih.gov nuccore CP002670 CP002670 Pyrococcus Pyrococcus ... al. title Complete genome sequence of the obligate piezophilic hypertheromphilic archaeon Pyrococcus ... of the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1 and comparison with Pyrococcus ...   more details



  1. CRISPR

    found in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs ... Hale C, Kleppe K, Terns RM, Terns MP title Prokaryotic silencing psi RNAs in Pyrococcus furiosus ...   more details



  1. RNase P

    , Gopalan V title Functional reconstitution and characterization of Pyrococcus furiosus RNase P journal ... the optimum temperature for the ribonuclease P activity from Pyrococcus horikoshii OT3 journal ...   more details



  1. Polymerase chain reaction optimization

    from Pyrococcus furiosus and Pwo, which is extracted from Pyrococcus woesii . Citation needed ...   more details



  1. Hezzelin I

    Unreferenced date December 2009 Hezzelin I also called Hezilo or Hermann , Count in Zulpichgau died 1033 , son of Hermann I, Count Palatine of Lotharingia count palatine Hermann I of Lotharingia . He married a daughter of Duke Conrad I, Duke of Carinthia Conrad I of Duchy of Carinthia Carinthia and had at least two sons Henry I, Count Palatine of Lotharingia Heinrich I Furiosus , Count Palatine of Lotharingia from 1045 until 1060 Conrad III, Duke of Carinthia Conrad III of Zulpichgau, Duke of Duchy of Carinthia Carinthia from 1056 until 1061 died 1061 . DEFAULTSORT Hezzelin 01 Category Palatinate of Lotharingia Category German nobility Category 1033 deaths Category Year of birth unknown ...   more details



  1. Galactokinase

    protein Name Galactokinase 1 caption Cartoon structure of a human galactokinase 1 monomer in complex with galactose red and an adenosine triphosphate ATP analog chemistry analogue orange . A magnesium ion is visible as a green sphere. From PDB 1WUU image Galactokinase 1 1WUU.png width HGNCid 4118 Symbol GALK1 AltSymbols GALK EntrezGene 2584 OMIM 604313 RefSeq NM 000154 UniProt P51570 PDB ECnumber 2.7.1.6 Chromosome 17 Arm q Band 23 LocusSupplementaryData q25 protein Name Galactokinase 2 caption image width HGNCid 4119 Symbol GALK2 AltSymbols EntrezGene 2585 OMIM 137028 RefSeq NM 002044 UniProt Q01415 PDB ECnumber 2.7.1.6 Chromosome 15 Arm Band LocusSupplementaryData Galactokinase is an enzyme that facilitates the phosphorylation of galactose D galactose to galactose 1 phosphate at the expense of one molecule of adenosine triphosphate ATP . Galactokinase catalyzes the second step of the Leloir pathway , a metabolic pathway found in most organisms for the catabolism of D galactose to glucose 1 phosphate . ref name l First isolated from mammal mammalian liver , galactokinase has been studied extensively in yeast , ref name c1 ref name c2 archaea , ref cite journal last Hartley A, Glynn SE, Barynin V, Baker PJ, et al title Substrate specificity and mechanism from the structure of Pyrococcus furiosus galactokinase journal J Mol Biol year 2004 month Mar volume 337 issue 2 pages 387 98 pmid 15003454 doi 10.1016 j.jmb.2004.01.043 first1 Andrew last2 Glynn first2 Steven E. last3 Barynin first3 Vladimir last4 Baker first4 Patrick J. last5 Sedelnikova first5 Svetlana E. last6 Verhees first6 Corn last7 De Geus first7 Daniel last8 Van Der Oost first8 John last9 Timson first9 David J. ref plants , ref cite journal last Foglietti MJ, Percheron F title Purification and mechanism of action of a plant galactokinase journal Biochimie year 1976 volume 58 issue 5 pages 499 504 pmid 182286 first1 MJ last2 Percheron first2 F ref ref cite journal last Dey PM title Galactokinase of Vic ...   more details



  1. Biomining

    Biomining is a new approach to the extraction of desired mineral s from ore s being explored by the mining industry in the past few years. Microorganism s are used to leach out the minerals, rather than the traditional methods of extreme heat or toxic chemicals, which have a deleterious effect on the environment. Overview The development of industrial mineral processing has been established now in several countries including South Africa , Brazil and Australia . Iron and sulfur oxidizing microorganisms are used to release occluded copper , gold and uranium from mineral sulfides . Most industral plants for biooxidation of gold bearing concentrates have been operated at 40  C with mixed cultures of mesophilic bacteria of the genera Thiobacillus or Leptospirillum ferrooxidans . In subsequent studies the dissimulatory iron reducing archaea Pyrococcus furiosus and Pyrobaculum islandicum were shown to reduce gold chloride to insoluble gold. Using Bacteria such as Acidithiobacillus ferrooxidans to leach copper from mine tailings has improved recovery rates and reduced operating costs. Moreover, it permits extraction from low grade ores an important consideration in the face of the depletion of high grade ores. The potential applications of biotechnology to mining and processing are countless. Some examples of past projects in biotechnology include a biologically assisted in situ mining program, biodegradation methods, passive bioremediation of acid rock drainage, and bioleaching of ores and concentrates. This research often results in technology implementation for greater efficiency and productivity or novel solutions to complex problems. Additional capabilities include the bioleaching of metals from sulfide materials, phosphate ore bioprocessing, and the bioconcentration of metals from solutions. One project recently under investigation is the use of biological methods for the reduction of sulfur in coal cleaning applications. From in situ mining to mineral processing ...   more details



  1. Thermococcus kodakarensis

    of a thermostable thiol protease from a newly isolated hyperthermophilic Pyrococcus ... kodakaraensis sp. nov., a well studied hyperthermophilic archaeon previously reported as Pyrococcus ... kodakaraensis KOD1 and comparison with Pyrococcus genomes. Genome Research 15 352 363. ref ...   more details



  1. List of homing endonuclease cutting sites

    explore explore.do?structureId 1DQ3 1DQ3 Pyrococcus furiosus Pyrococcus furiosus Vc1 align center archaea ... 2CW7 2CW7 Pyrococcus kodakaraensis Pyrococcus kodakaraensis KOD1 align center archaea A code ... Pyrococcus Pyrococcus sp. align center archaea A align center chromosome chrm code 5 TGGCAAACAGCTATTATGGGTATTATGGGT ...   more details



  1. University of Regensburg

    between 1980 and 2002. Among his discoveries were Pyrococcus furiosus in 1986, Aquifex aeolicus , Aquifex ...   more details



  1. DNA clamp

    nuclear antigen from Pyrococcus furiosus journal Protein Sci. volume 10 issue 1 pages 17 23 year 2001 ...   more details



  1. Transition metal oxo complex

    Active Forms of the Three Tungstoenzymes in the Hyperthermophilic Archaeon Pyrococcus furiosus ...   more details



  1. Nitrilase

    protein Name nitrilase 1 caption X ray crystallography Biological macromolecular crystallography Crystallographic structure of Pyrococcus Pyrococcus abyssi nitrilase. ref name Raczynska 2010 PDB 3IVZ cite journal author Raczynska J, Vorgias C, Antranikian G, Rypniewski W title Molecular basis of specificity of hyperthermophilic nitrilase journal to be published year 2010 ref image 3IVZ.pdb.png width HGNCid 7828 Symbol NIT1 AltSymbols EntrezGene 4817 OMIM 604618 RefSeq NM 005600 UniProt Q86X76 PDB 3IVZ ECnumber Chromosome 1 Arm Band LocusSupplementaryData pter qter Nitrilase enzymes nitrile aminohydrolase EC number 3.5.5.1 catalyse the hydrolysis of nitrile s to carboxylic acid s and ammonia , without the formation of free amide intermediates. Nitrilases are involved in natural product biosynthesis and post translational modifications in plants, animals, fungi and certain prokaryotes. Nitrilases can also be used as catalysts in preparative organic chemistry. Among others, nitrilases have been used for the resolution of racemic mixture s. Nitrilase should not be confused with nitrile hydratase nitrile hydro lyase EC number 4.2.1.84 which hydrolyses nitriles to amides. Nitrile hydratases are almost invariably co expressed with an amidase, which converts the amide to the carboxylic acid, consequently it can sometimes be difficult to distinguish nitrilase activity from nitrile hydratase plus amidase activity. Nitrilase is a polypeptide consisting of alpha helices and beta sheets. It is 262 residues in length and its structure was determined through x ray diffraction . The structure of nitrilase shown has a resolution of 1.57 angstroms or 0.157 nanometers nm . Nitrilase is an enzyme and therefore requires a ligand in order for it to become active. Magnesium ion is the ligand that is a tightly bound to the enzyme to allow for this activation. This information was taken from http www.pdb.org pdb explore explore.do?structureId 3IVZ Protein Data Bank References Reflist Exte ...   more details



  1. Group 6 element

    organisms, and tungsten has been identified in an analogous role in enzymes from some archaea , such as Pyrococcus furiosus . In contrast, and unusually for a first row d block transition metal, chromium ...   more details



  1. Ferredoxin

    cluster. In Pyrococcus furiosus Fe sub 4 sub S sub 4 sub ferredoxin, one of conserved Cys residues ...   more details



  1. Variants of PCR

    Pyrococcus furiosus , has proofreading activity, and a 5 fold decrease in the error rate of replication ...   more details



  1. Thermococcus gammatolerans

    Italic title Taxobox color lightgrey name Thermococcus gammatolerans image Thermococcus gammatolerans.jpg image caption Thermococcus gammatolerans domain Archaea phylum Euryarchaeota classis Thermococci ordo Thermococcales familia Thermococcaceae genus Thermococcus species T. gammatolerans binomial Thermococcus gammatolerans binomial authority Jolivet E. Jolivet , 2003 Thermococcus gammatolerans is an archaea extremophile and the most radiation resistant known organism. Discovered in 2003 in a submarine hydrothermal vent in the Guaymas Basin about 2,000 meters deep off the coast of California. Thermococcus gammatolerans thrives in temperatures between 55 95 C with an optimum development at approximately 88 C. The optimal growth pH is 6, favoring the presence of sulfur S , which is reduced to hydrogen sulfide H2S . It is the organism with the strongest radioresistance resistance to radiation , supporting a radiation of gamma rays from 30 K Grey unit Gy . ref Jolivet E, L Haridon S, Corre E, Forterre P, Prieur D. 2003 Thermococcus gammatolerans sp. nov., a hyperthermophilic archaeon from a deep sea hydrothermal vent that resists ionizing radiation. PMID 12807211 ref Along with the genera Palaeococcus and Pyrococcus , Thermococcus belongs to the Thermococcaceae family, sole family of the Thermococci called Protoarchaea by Cavalier Smith , a class in the phylum Euryarchaeota of Archaea. ref lpsn classifphyla.html Classification of phyla ref Thermococcus species live in extremely hot environments such as hydrothermal vents with a growth optimum temperature above 80 C. Thermococcus and Pyrococcus literally ball of fire are both organotrophic chemoorganotrophic Anaerobic organism anaerobic required. Thermococcus spp. prefer 70 95 C, whereas Pyrococcus prefer 70 100 C. The resistance to ionizing radiation of T. gammatolerans is enormous. While a dose of 5 Gy is sufficient to kill a human being, and a dose of 60 Gy is able to kill all cells in a colony of E. coli , Thermococ ...   more details



  1. SscA RNA

    Infobox rfam Name SscA RNA image RF00063.jpg width caption Predicted secondary structure and sequence conservation of SscA Symbol SscA AltSymbols Rfam RF00063 miRBase miRBase family RNA type Gene Tax domain Archaea GO SO SO 0000233 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The SscA RNA Secondary Structure Conserved A gene was identified computationally in AT rich hyperthermophile s using QRNA bioinformatics software. ref name Kle02 cite journal last Klein first RJ coauthors Misulovin Z, Eddy SR year 2002 title Noncoding RNA genes identified in AT rich hyperthermophiles journal Proc Natl Acad Sci USA volume 99 pages 7542&ndash 7547 pmid 12032319 doi 10.1073 pnas.112063799 issue 11 pmc 124278 ref SscA is 97 nucleotide s in length and is of unknown function. The predicted distribution of SscA RNA is currently restricted to the pyrococcus genus. ref name Kle02 Other RNAs identified with SscA include HgcC family RNA HgcC , HgcE RNA HgcE , HgcF RNA HgcF and HgcG RNA HgcG . ref name Kle02 References reflist 1 External links Rfam id RF00063 name SscA RNA Category Non coding RNA molecular cell biology stub ...   more details



  1. Mannosyl-3-phosphoglycerate synthase

    enzyme Name mannosyl 3 phosphoglycerate synthase EC number 2.4.1.217 CAS number 393512 63 5 IUBMB EC number 2 4 1 217 GO code 0050504 image width caption In enzymology , a mannosyl 3 phosphoglycerate synthase EC number 2.4.1.217 is an enzyme that catalysis catalyzes the chemical reaction GDP mannose 3 phospho D glycerate math rightleftharpoons math GDP 2 alpha D mannosyl 3 phosphoglycerate Thus, the two substrate biochemistry substrates of this enzyme are GDP mannose and 3 phospho D glycerate , whereas its two product chemistry products are guanosine diphosphate GDP and 2 alpha D mannosyl 3 phosphoglycerate . This enzyme belongs to the family of glycosyltransferase s, specifically the hexosyltransferases. The systematic name of this enzyme class is GDP mannose 3 phosphoglycerate 3 alpha D mannosyltransferase . This enzyme is also called MPG synthase . References reflist 1 cite journal author Empadinhas N, Marugg JD, Borges N, Santos H, da Costa MS date 2001 title Pathway for the synthesis of mannosylglycerate in the hyperthermophilic archaeon Pyrococcus horikoshii. Biochemical and genetic characterization of key enzymes journal J. Biol. Chem. volume 276 pages 43580&ndash 8 pmid 11562374 doi 10.1074 jbc.M108054200 issue 47 enzyme stub Category EC 2.4.1 Category Enzymes of unknown structure ...   more details



  1. Archease

    Infobox protein family Symbol Archease Name Archease image PDB 1jw3 EBI.jpg width caption solution structure of methanobacterium thermoautotrophicum protein 1598. ontario centre for structural proteomics target mth1598 1 140 northeast structural genomics target tt6 Pfam PF01951 Pfam clan InterPro IPR002804 SMART PROSITE MEROPS SCOP 1jw3 TCDB OPM family OPM protein CAZy CDD In molecular biology, the archease Protein family superfamily of protein s are represented in all three Domain biology domains of life . Archease genes are generally located adjacent to gene s encoding protein proteins involved in DNA or RNA processing and therefore been predicted to be modulators or chaperone protein chaperones involved in DNA or RNA metabolism Regulation and control metabolism . Many of the roles of archeases remain to be established experimentally. The function of one of the archeases from the hyperthermophile Pyrococcus abyssi has been determined. The gene encoding the archease PAB1946 is located in a bicistronic operon immediately upstream and downstream DNA upstream from a second open reading frame PAB1947 , which encodes a tRNA m5C methyltransferase . The methyl transferase catalysis catalyses m5C formation at several cytosine s within tRNAs with preference for C49 the pecificity of the methyltransferase reaction being increased by the archease. The archease exists in monomeric and oligomeric states, with only the oligomeric forms able to Molecular binding bind the methyltransferase. Binding molecular Binding prevents protein aggregation aggregation and hinders dimerisation of the methyltransferase tRNA Protein complex complex . ref name pmid17470432 cite journal author Auxilien S, El Khadali F, Rasmussen A, Douthwaite S, Grosjean H title Archease from Pyrococcus abyssi improves substrate specificity and solubility of a tRNA m5C methyltransferase journal J. Biol. Chem. volume 282 issue 26 pages 18711 21 year 2007 month June pmid 17470432 doi 10.1074 jbc.M607459200 url ref ...   more details




Articles 26 - 50 of 91      Previous     Next


Search   in  
Search for Pyrococcus furiosus in Tutorials
Search for Pyrococcus furiosus in Encyclopedia
Search for Pyrococcus furiosus in Videos
Search for Pyrococcus furiosus in Books
Search for Pyrococcus furiosus in Software
Search for Pyrococcus furiosus in DVDs
Search for Pyrococcus furiosus in Store


Advertisement




Pyrococcus furiosus in Encyclopedia
Pyrococcus furiosus top Pyrococcus furiosus

Home - Add TutorGig to Your Site - Disclaimer

©2011-2013 TutorGig.info All Rights Reserved. Privacy Statement