The term RNAediting describes those molecular processes in which the information content in an RNA molecule ... in tRNA , rRNA , mRNA and microRNA molecules of eukaryotes but not prokaryotes . RNAediting occurs ... to have evolved from prokaryotic like endosymbionts . Most of the RNAediting processes, however, appear to be evolutionarily recent acquisitions that arose independently. The diversity of RNAediting ... I deaminations, as well as non templated nucleotide additions and insertions. RNAediting in mRNAs ... 1999 title RNAediting journal FEMS Microbiol Rev volume 23 issue 3 pages 297 316 doi 10.1111 j.1574 ... by insertion or deletion RNAediting through the addition and deletion of uracil has been found ..., R. year 1994 title RNAediting in trypanosomes journal Eur. J. Biochem volume 221 pages 9 23 doi ..., R. year 1996 title Mechanism and evolution of RNAediting in kinetoplastida journal Biochim ... RNAediting in kinetoplastid mitochondria journal Nucleic Acids Res. volume 25 pages 3751 3759 doi ..., L. year 1990 title A model for RNAediting in kinetoplastid mitochondria Guide RNA molecules ..., M.L., Heidmann, S. and Stuart, K.D. year 1997 title RNAediting getting U into RNA journal Trends ... year 1995 title Sense from nonsense RNAediting in mitochondria of kinetoplastid protozoa and slime .... ref name Stuart 8 cite journal author Stuart, K. year 1991 title RNAediting in mitochondrial mRNA ..., DC. pages 377 394 work Modification and Editing of RNA Grosjean, H. and Benne, R., Eds. unused ... requiring extensive editing will need more than one guide RNA and editosome complex. Editing ... Apobgene.PNG 300px thumb The Effect of C U RNAEditing on the Human ApoB gene A I editing A to I editing ... RNAEditing Underlies Temperature Adaptation in K Channels from Polar Octopuses journal Science ... SN, inhibition of miRNA and siRNA processing,and altered splicing. RNAediting in plant mitochondria and plastids It has been shown in previous studies that the only types of RNAediting seen in the plants ... more details
of human SNP database identifies recoding sites of A to I RNAediting journal RNA volume 14 issue 10 ... cgi pmidlookup?view long&pmid 18772245 ref RNAEDITING The two editing sites were previously ... to inosine RNAediting journal Nucleic Acids Res. volume 33 issue 4 pages 1162 8 year 2005 pmid ... 15731336 ref Editing type A to I RNAediting is catalyzed by a family of adenosine deaminases acting on RNA ADARs that specifically recognize adenosines within double stranded regions of pre mRNAs ... of RNA are formed by base pairing between residues in the close to region of the editing site with residues ..., Seeburg PH title Liver disintegration in the mouse embryo caused by deficiency in the RNAediting ... of cell growth and angiogenesis. ref name pmid18772245 See also GABRA3 RNAEditing CYFIP2 RNAEDITING CYFIP2 RNAediting KCNA1 RNAediting KCNA1 RNAEditing ARL6IP4 RNAEditing BLCAP RNAEditing BLCAP RNAediting KCNA1 RNAediting FLNA RNAediting C1QL1 RNAediting References Reflist External ... with the editing region is known as an Editing Complentary Sequence ECS . It is thought that the pre mRNA of IGFBP7 is a substrate for ADAR1 based on the expression spectrum of the editing enzyme. ref ... Editing sites The pre mRNA of this protein is edited at two positions. These editing sites occur within ... 95. The editing complementary sequence ECS is located in a region within the coding sequence about 200 base pairs upstream from the editing sites. The ECS forms 140 bp duplex structure. ref name pmid15731336 The A to G discrepancies for these two editing sites were confirmed experimentally to be RNAediting by analyzing matched cDNA and genomic dna sequences from the same tissue sample. ref ..., in theory, continue to undergo editing as mature mRNA. A third candidate editing site did not show evidence of RNAediting in sequence analysis, which may be an indication that either the RNAediting process is tissue specific, or editing occurs at a low frequency. One other possible explanation is that these edits ... more details
for each subunit. 5 RNAeditingEditing type The type of editing A to I editing. Adenosine deaminase s acting on RNA ADARs are the RNAediting enzyme s involved in the editing of GRIA2 pre mRNA.ADARs deaminate adenosine bases to inosine bases in a site specific manner in double stranded RNA substrates dsRNA . ADA2 has been proven experimentally to be the editing enzyme. Editing site The pre mRNA ... Academy of Sciences of the United States of America, 91, 10270 10274. ref Effects of Rnaediting Protein structure The genomically encoded GluR2 subunit has a Gln CAG at the editing site position. Editing of the pre mRNA results in an Arg CGG being encoded at this position. ref Sommer, B., Kohler .... Editing regulation Editing occurs in 100 of transcripts from human brain but editing levels are less so in other tissues.Deletion analysis determined that editing requires 5 portion inton B. The predicted minimum fragment required for editing to occur contains inverted repeat structure separated .... Dysfunctional editing Thiamine Vitamin B1 deficiency Deficiency of this vitamin has been shown to cause alterations in editing of Glur2 pre mRNA.Thiamine deficiency leads to mild impairment of oxidative ... of lack of thiamine. Deficiency also inhibits editing of the Q R site of Glur2 thereby increasing the level .... References Reflist External sources http darned.ucc.ie Category RNA Category Genes ... more details
Infobox rfam Name Potassium channel RNAediting signal image RF00485.jpg width caption Predicted secondary structure and sequence conservation of K chan RES Symbol K chan RES AltSymbols Rfam RF00485 miRBase miRBase family RNA type Cis regulatory element Cis reg Tax domain Eukaryota GO SO SO 0000233 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData The potassium channel RNAediting signal is an cis regulatory element RNA element found in human Kv1.1 and its homologues which directs the efficient modification of an adenosine to inosine by an adenosine deaminase acting on RNA ADAR . The ADAR modification causes an isoleucine valine recoding event which lies in the ion conducting pore of the potassium channel . It is thought that this editing event targets the process of fast inactivation and allows a more rapid recovery from inactivation at negative potentials. ref cite journal last Bhalla first T coauthors Rosenthal JJ, Holmgren M, Reenan R year 2004 title Control of human potassium channel inactivation by editing of a small mRNA hairpin journal Nat Struct Mol Biol volume 11 pages 950&ndash 956 pmid 15361858 doi 10.1038 nsmb825 issue 10 ref References reflist 1 External links Rfam id RF00485 name Potassium channel RNAediting signal Category Cis regulatory RNA elements molecular cell biology stub ... more details
en ra b .nju kle . k s d , or RNA , is one of the three major macromolecule s along with DNA and protein s essential for all known forms of life . Like DNA, RNA is made up of a long chain of components ... group. The sequence of nucleotides allows RNA to encode genetic information. All cellular organisms use messenger RNA mRNA to carry the genetic information that directs the synthesis of proteins. In addition, many virus es use RNA instead of DNA as their genetic material. Some RNA molecules play ... on ribosome s. This process uses transfer RNA tRNA molecules to deliver amino acids to the ribosome, where ribosomal RNA rRNA links amino acids together to form proteins. The chemical structure of RNA is very similar to that of DNA, with two differences a RNA contains the sugar ribose , while DNA contains ... RNA has the nucleobase uracil while DNA contains thymine . Unlike DNA, most RNA molecules are single ... of the ribosome 3CC2.png thumb Three dimensional representation of the 50S ribosomal subunit. RNA is in ochre, protein in blue. The active site is in the middle red . RNA and DNA are both nucleic acid s, but differ in three main ways Unlike double stranded DNA, RNA is a single stranded molecule ... , RNA contains ribose in deoxyribose there is no hydroxyl group attached to the pentose ring in the nucleic acid nomenclature 2 position . These hydroxyl groups make RNA less stable than DNA because ... RNA s, contain self complementary sequences that allow parts of the RNA to fold ref citation author I. Tinoco and C. Bustamante title How RNA folds journal J. Mol. Biol. volume 293 pages 271 281 ..., RNAs can achieve chemical catalysis , like enzymes. ref cite journal author Higgs PG title RNA ... active site is composed entirely of RNA. ref name ribosome activity cite journal author Nissen ... base pairs in a siRNA hydrogen atoms are not shown Each nucleotide in RNA contains a ribose sugar, with carbons .... The phosphate groups have a negative charge each at physiological pH, making RNA a charged molecule ... more details
wiktionary photo wiktionary editing Photo editing can refer to Image editing techniques applied to photographs. Photo manipulation , the use of image editing to create an illusion or deception. See also Image processing disambig ... more details
In camera editing is the technique in filmmaking and video production of shooting Shot filmmaking shots in the exact sequence that they will be seen on the movie theater screen or television program . This means planning in advance what shots will tell the desired story and then shooting only those shots in that order, as opposed to the usual filmmaking technique of shooting multiple take s out of sequence, then film editingediting them into order to tell the story. ref cite web url http www.personal.kent.edu lhanson incamera.htm title In Camera Editing accessdate 2008 03 20 last Hanson first LuEtt work Videography Basics Online Textbook publisher Kent State University ref Newer professional video camera s have the ability to perform simple in camera video editing . References reflist Category Film and video technology Category Television terminology filming stub ... more details
Simultaneous editing may refer to a technique in the Lapis text editor Lapis text editor that allows the user to manipulate all items in a multiple selection at once through direct manipulation. collaborative real time editing of the same document by several users in workgroup tools. disambig ... more details
Cleanup date April 2008 Image Mesa de v deo 1.JPG right thumb A vision mixer. The term video editing can refer to Linear video editing , using video tape Non linear editing system NLE , using computers with video editing software Offline editing Online editing Vision mixing , when working within live television and video production environments Background Video editing is the process of editing segments ... process. Motion picture film editing is a predecessor to video editing and, in several ways, video editing simulates motion picture film editing, in theory and the use of linear video editing and video editing software on non linear editing system s NLE . Using video, a director can communicate non fictional and fictional events. The goals of editing is to manipulate these events to bring the communication ... magnetic tape and was introduced into the linear editing technique. If a scene closer to the beginning ... by video editing software such as Sony Vegas , CyberLink PowerDirector , Avid Technology s Media Composer ... more popular and can be readily edited using the same video editing software along with related motion ... media web streaming , QuickTime Movies, iPod, CD ROM , or video tape. Home video editing Like many other technologies, the cost of video editing has declined by an order of magnitude or more. The 2 Quadraplex ... unit and editing was a highly involved process requiring special training. In contrast, nearly any home ... definition television SDTV . The two major retail operating systems include basic video editing software ..., opensource video editing programs. These include Avidemux , VirtualDub , Kdenlive , PiTiVi , Kino software Kino , Openshot and Cinelerra . A new free and collaborative video editing platform called ... for a unified video real. Automatic video editing products have also emerged, opening up video editing ... Technologies introduced their PC based automatic video editing platform, autoProducer, in 2001. Other ... ref In September 2011, Magisto introduced a cloud based automatic video editing solution that uses proprietary ... more details
Genetic editing French language French critique g n tique German language German genetische Kritik is an approach to scholarly editing in which an exemplar is seen as derived from a dossier of other manuscript s and events. The derivation can be through physical Cut, copy, and paste cut and paste writing or drawing in a variety of media quotation, annotation or correction acts of physical defacement etc. Genetic editing aims to reconstruct the sequence of actions on the manuscript and exactly which parts of the manuscript were acted upon. Where multiple manuscripts have been combined through for example cut and paste or quotation . ref http www.textualscholarship.org gencrit index.html ref ref http www.cts.dmu.ac.uk index.php?q objectives.html ref ref http www.jstor.org pss 30227768 ref Genetic editing is strong in European, particularly French and German, textual criticism . Completed works of genetic editing are known as genetic editions. Whereas traditional scholarly editing can be seen to as constructing a new document drawing together and comparing many source documents to cast light on a work, genetic editing closely examines a single extant manuscript and traces back each aspect to cast light on the work. Genetic editing is named by analogy with genetics manuscripts individuals are derived from other manuscripts or previous states of the same manuscript and with the derivation tree being a partial Tree data structure ordered tree . As of 2011, there is an active proposal to add genetic editing support to the Text Encoding Initiative s XML format. ref http www.tei c.org Activities Council Working tcw19.html ref Examples HyperNietzsche http www.hypernietzsche.org Ulysses A Critical and Synoptic Edition 1984 Gabler, Steppe, and Melchior ISBN 0824043758 References Reflist Category Digital humanities Category Editing Category Textual criticism ... more details
unreferenced date May 2008 Offline editing is part of the post production process of filmmaking and television ... film stock or video tape . Once the project has been completely offline video editing edited , the original media will be assembled in the online editing stage. The term offline originated in the computing ... . Modern offline video editing is conducted in a non linear editing NLE suite. The digital revolution has made the offline editing workflow process immeasurably quicker, as practitioners moved from time consuming video tape to tape linear video editing online editing suites, to computer hardware and video editing software such as Adobe Premiere , Final Cut Pro , Avid , Sony Vegas and Lightworks ... to create the final cut. History From film to tape Film editing used an offline approach almost ... this process was used to assemble scenes together, not for creative editing. The second option for video editing was to use two tape machines, one playing back the original tapes, and the other recording ... from Communication source source to edit master came to be known as linear video editing . This was the way ... developments Three developments of the late sixties and early seventies revolutionized video editing ... frame numbers by watching this tape. Exact editing Though both of these developments helped greatly, effectively creating the offline editing method, they didn t solve the problem of precisely controlling the video recorder for frame accurate editing. That required precise control of the tape ... of editing video directly that had all of the creative control of traditional film editing. The result ..., re editing was trivial, as no cuts were actually performed. The shots were simply accessed ... attempt at non linear editing on video was abandoned as too expensive, the rest of the hardware ... would offline on a less expensive, low quality format, before entering the online editing suite ... . See also Direct to disk recording DTE Direct To Edit Non destructive editing Tapeless camcorder ... more details
more footnotes date August 2011 Journalism Copy editing also written as copy editing or copyediting , and sometimes abbreviated to ce is the work that an editing editor does to improve the Text formatting format ting, style, and accuracy of text. Unlike general editing, copy editing might not involve changing the substance of the text. copy written Copy refers to written or typewritten text for typesetting , printing , or publication . Copy editing is done before both typesetting and proofreading , the latter of which is the last step in the editorial cycle. In the U.S. and Canada, an editor who ... editors should make it say what it means, and mean what it says . Typically, copy editing involves ... is a distinct task from copy editing, frequently it is one of the tasks performed by copy ... of computerised systems for editing and layout in newspapers and magazines has also led copy editors ... States, copy editing is often taught as a college journalism course, though its name varies. The courses ... give copy editing job candidates an editing test or a tryout. These vary widely and can include ... Stylebook Associated Press style , headline writing, infographics editing, and journalism ethics . In both ... American copy editors American Copy Editors Society AP Stylebook Editing ColBreak Fact checker ... Reflist References The Art of Editing, by Floyd K. Baskette, Jack Z. Sissors, and Brian S. Brooks ... Butcher s Copy editing The Cambridge Handbook for Editors, Copy editors and Proofreaders place Cambridge ... links Wiktionary General http www.subediting.com Sub editing style and directories1 UK http www.pgdp.net ... UK http www.stc techedit.org Technical Editing special interest group SIG of the Society for Technical Communication STC Newspaper copy editing The Slot, includes http theslot.com copyeditors.html ... author Bill Walsh of Washington Post The Washington Post Category Copy editing Category Technical ... simple Copy editing ... more details
Unreferenced date December 2009 Online editing is an older post production linear video editing process that is performed in the final stage of a video production . It occurs after offline editing . For the most part online editing has been replaced by video editing software that operate on non linear editing system s NLE . The term online originated in the telecommunication industry, meaning Under the direct control of another device automation . Online editors such as the http www.vtoldboys.com sonybve.htm Sony BVE 9000 edit control unit used the RS 422 remote control 9 Pin Protocol to allow the computer interface of edit controllers to control video tape recorder s VTR via a series of commands. The protocol supports a variety of devices including one inch reel to reel type C videotape as well as videocassette recorder s VCR to Fast Forward, Rewind and Play and Record based on SMPTE timecode . The controllers have the ability to interface with professional audio equipment like audio mixer s with console automation . The video quality first introduced with Avid s Media Composer in 1989 was incapable of producing broadcast quality images due to computer processing limitations. The term Online changed from its original meaning to where the pictures are re assembled at full or online Optical resolution resolution . An edit decision list EDL or equivalent created during the offline edit is used to carry over the cuts and dissolves from the. This conform is checked against a video copy of the offline edit to verify that the edits are correct and frame accurate. This workprint cutting copy in the UK also provides a reference for any digital video effects that need to be added. After conforming the project, the online editor will add visual effects , lower third titles, and apply ... at all. DEFAULTSORT Online Editing Category Film and video technology Category Television terminology de Online Editing ... more details
Film editing is part of the creative post production process of filmmaking . It involves the selection ... motion picture . It is an art of storytelling . Film editing is the only art that is unique ... , dance , writing , and Theater director directing , although there are close parallels to the editing process in other art forms like poetry or novel writing. Film editing is often referred to as the invisible ... is not even aware of the editor s work. On its most fundamental level, film editing is the art, technique ... film editing by assembling the footage. However, the job of an editor isn t simply to mechanically .... Editors usually play a dynamic role in the making of a film. With the advent of digital editing, film ... aspects of the editing process, usually under the direction of the picture editor and director ... teams hired to complete the picture. Film editing is an art that can be used in diverse ways. It can ... is generally thought to be the American filmmaker who first put film editing to use. Porter worked .... There was no story and no editing. Each film ran as long as there was film in the camera. When Edison ... shown in film schools today as an example of early editing form. It was produced in 1903 and was one of the first examples of dynamic, action editing piecing together scenes shot at different times ... act of juxtaposing the shots in a sequence made the relationship. History of film editing technology Image FirstMoviola.jpg thumb 250px The original editing machine an upright Moviola . Image Steenbeck rollers.jpg thumb 250px Steenbeck film editing machine rollers Before the widespread use of non linear editing system s, the initial editing of all films was done with a positive copy of the film .... Post production main Post production Editor s cut main Editor s cut see also Rough cut Offline editing Online editing There are several editing stages and the editor s cut is the first. An editor s cut ... the entire editing process goes on for many months and sometimes more than a year, depending on the film ... more details
Refimprove date November 2009 Original research date March 2010 Continuity editing is the predominant style of film editing and video editing in the post production process of filmmaking of narrative film s and television program s. The purpose of continuity editing is to smooth over the inherent discontinuity of the editing process and to establish a logical coherence between shots. In most films, logical coherence is achieved by cutting to continuity, which emphasizes smooth transition of time and space. However, some films incorporate cutting to continuity into a more complex classical cutting technique, one which also tries to show psychological continuity of shots. The Montage filmmaking montage technique relies on symbolic association of ideas between shots rather than association of simple physical action for its continuity. Common techniques of continuity editing Continuity editing can be divided into two categories temporal continuity and spatial continuity. Within each category, specific techniques will work against a sense of continuity. In other words, techniques can cause a passage to be continuous, giving the viewer a concrete physical narration to follow, or discontinuous ... the nature of the specific ellipses are the dissolve film dissolve and the fade. Other editing styles ... served to disorient the viewer. One way of preventing viewer disorientation in editing is to adhere ... may not become particularly disoriented, but under the principle of spatial continuity editing ... than 30 degrees from one another. Discontinuous editing Discontinuous editing describes the deliberate or accidental violation of rules of continuity when Film editingediting films . As a deliberate ... hypersignification.html accessdate 2007 12 22 ref It is also known as montage editing , and employs ... 07 331027 1 oclc doi See also Soviet montage theory Discontinuity editing Montage sequence Montage film Continuity Editing DEFAULTSORT Continuity Editing Category Film editing de Unsichtbarer Schnitt ... more details
Receptor editing is a process that occurs during the maturation of B cells , which are part of the adaptive immune system. This proccess forms part of central tolerance to attempt to change the specificity of the antigen receptor of self reactive immature B cells, in order to rescue them from programmed cell death, called apoptosis . ref name pmid8848883 cite journal author Meffre, E, Wardemann, H title B cell tolerance checkpoints in health and autoimmunity. journal Current Opinion in Immunology volume 20 issue pages 632 638 year 2008 month pmid 8848883 doi 10.1016 j.coi.2008.09.001 ref It is thought that 20 50 of all peripheral naive B cells have undergone receptor editing making it the most common method of removing self reactive B cells. ref name pmid15156139 cite journal author Halverson R, Torres RM, Pelanda R title Receptor editing is the main mechanism of B cell tolerance toward membrane antigens journal Nature Immunology volume 6 issue pages 645 650 year month pmid 15156139 doi 10.1038 ni1076 ref During maturation in the bone marrow, B cells are tested for interaction with self antigens, which is called negative selection . If the maturing B cells strongly interact with these self antigens, they undergo death by apoptosis. Negative selection is important to avoid the production of B cells that could cause autoimmune diseases . They can avoid apoptosis by modifying the sequence of light chain V and J genes components of the antigen receptor so that it has a different specificity and may not recognize self antigens anymore. This process of changing the specificity of the immature B cell receptor is called receptor editing. References Reflist Category Medicine ... more details
Orphan date June 2011 Choice editing refers to the active process of controlling or limiting the choices available to consumers so as to drive to an end goal. The term has gained currency in discussions about sustainability . Definition The Sustainable Development Commission defined choice editing as ...shifting the field of choice for mainstream consumers cutting out unnecessarily damaging products and getting real sustainable choices on the shelves. ref name SDC2006 cite report publisher Sustainable Development Commission url http www.sd commission.org.uk data files publications Looking back SCR.pdf title Looking Back, Looking Forward Lessons in Choice Editing for Sustainability date May 2006 page 2 ref The process involves ... removing environmentally offensive products from commercial consideration or making such products expensive to use. ref name Maniates cite web url http webpub.allegheny.edu employee m mmaniate choice editing Maniates.pdf first Michael last Maniates title Editing out Unsustainable Behavior ref Choice editing is a direct control of the impact from consumption and aims to only provide sustainable products in the market. Not only products can be edited out or replaced ... from a business perspective year 2008 ref History Choice editing is nothing new. It has been around ... choice editing was a major driver of green innovations, which suggests its potential to increase ... title Choice Editing date 20 January 2011 url http www.mst.dk English SustainableConsumptionandProductionintheNordicRetailSector ... Editing by policy makers light bulb ban The Australia n government phased out incandescent light ... free brand Cascola. Editing the supply chain Adidas Adidas supports its suppliers in order ... of its supply chain. ref name WBCSD Editing processes Tijin Tijin is a Japanese company operating ... containing recycled polyester. ref name WBCSD Editing the corporate behavior Hipp As assessed ... their choices? Who decides what is removed and why? Some argue that instead of choice editing, labeling ... more details
about the uses, cultural impact, and ethical concerns of image editing Photo manipulation the process of culling and archiving images Digital asset management File MigrantMotherColorized.jpg right thumb A colorized version of originally black and white photo, colorized using GIMP File Lange MigrantMother02.jpg ... , taken by Dorothea Lange in 1936. Image editing encompasses the processes of altering image s, whether ... photograph s, or illustration s. Traditional analog image editing is known as Retouching photo retouching , using tools such as an airbrush to modify photographs, or editing illustrations with any traditional ..., enhance, and transform images. Many image editing programs are also used to artistic rendering render or create computer art from scratch. Basics of image editing Raster graphics Raster images ... at any Image resolution resolution . Automatic image enhancement Camera or computer image editing ... imbalances as well as other image editing features, such as Red eye effect red eye removal ... or mouse button or by selecting an option from a menu. Additionally, some automatic editing features offer a combination of editing actions with little or no user interaction. Digital data compression ... main Layers digital image editing Another feature common to many graphics applications is that of Layers digital image editing Layers , which are analogous to sheets of transparent cellulose acetate ... while maintaining non destructive editing principles and ease of use. Image size alteration ... Layers digital image editing layers . The background image is used as the bottom layer, and the image ... of images A more recent tool in digital image editing software is the image slicer. Parts of images ... File Photo editing contrast correction.jpg right thumb An example of contrast correction. Left ... details that would be hard to see on most computer monitors out of shadows. In some image editing ... Image Editing Category Digital photography Category Graphic design Category Image processing Category ... more details
mRNA s in kinetoplastid protist s in a process known as RNAediting . Overview of gRNA directed editing Trypanosomatid protists and other kinetoplastid s have a novel post transcriptional mitochondrial RNA modification process known as RNAediting . The mitochondrial genome in these cells consists ... by short guide RNA gRNAs which encode the editing information in the form of complementary ... using this process. One such gene is Cyb. ref cite web title Uridine insertion deletion RNAediting ... information that corrects errors in the other genome, is novel. Editing proceeds generally 3 to 5 on the mRNA. The initial editing event occurs when a gRNA forms an RNA duplex with a complementary mRNA sequence just downstream of the editing site. This then recruits a number of ribonucleoprotein ... the duplex upstream. The adjacent upstream editing site is then modified in the same manner. A single gRNA usually encodes the information for several editing sites an editing block , the editing of which ... gRNA then forms a duplex with the edited mRNA sequence and initiates another round of editing. The overlapping gRNAs form an editing domain . In some genes there are multiple editing domains. The extent of editing for any particular gene varies between trypanosomatid species. The variation consists of the loss of editing at the 3 side, probably due to the loss of minicircle sequence classes ... cases, complete, loss of editing in evolution. Loss of editing is lethal in most cases, although losses have been seen in old laboratory strains. The maintenance of editing over the long evolutionary ... is now repaired by adding U s at each editing site in succession, giving the sequence gRNA 3 AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA ... gene has two overlapping gRNA editing sites. The 5 end of this section is the 3 anchor for another gRNA gCyb II gRNA . References Refimprove date November 2009 reflist nucleic acids Category RNA ru GuideRNA zh RNA ... more details
Orphan date February 2009 Unreferenced date January 2008 Preribosomal RNA is a non complete RNA that serve as the intermediate form during RNA biogenesis. Long comment to avoid being listed on short pages Category RNA Cell biology stub ... more details
RNA stands for ribonucleic acid, a biological macromolecule. RNA may also refer to RNA journal RNA journal , a scientific journal Religion Newswriters Association Republic of New Afrika , a black nationalist community and political lobby group Rochester Numismatic Association Romantic Novelists Association The Royal National Agricultural and Industrial Association of Queensland , organiser of the Ekka Royal Navy Association , a form of auxiliary for the Royal Navy United Kingdom Royal Nepalese Army Royal Nepal Airlines Radio Nacional de Angola , Angola National Radio disambig Category Initialisms es RNA desambiguaci n eo RNA apartigilo fr RNA gl RNA it RNA disambigua nl RNA pt RNA desambigua o zh RNA ... more details
RNA journal may refer to RNA journal , a Cold Spring Harbor Laboratory Press scientific journal RNA Biology , a Landes Bioscience scientific journal disambig ... more details
Image MRNA interaction.png thumb 300px The life cycle of an mRNA in a eukaryote eukaryotic cell. RNA .... Messenger RNA mRNA is a molecule of RNA that encodes a chemical blueprint for a protein ... . This process of translation of codons into amino acids requires two other types of RNA Transfer RNA tRNA , that mediates recognition of the codon and provides the corresponding amino acid, and ribosomal RNA rRNA , that is the central component of the ribosome s protein manufacturing machinery ... genetics Transcription is when DNA makes RNA. During transcription, RNA polymerase makes .... One notable difference, however, is that prokaryotic RNA polymerase associates with mRNA processing ... 5 cap A 5 cap also termed an RNA cap, an RNA 7 methylguanosine cap, or an RNA m sup 7 sup G cap is a modified guanine nucleotide that has been added to the front or 5 end of a eukaryotic messenger RNA ... associated with RNA polymerase . This enzyme enzymatic complex catalyze s the chemical reactions ... splicing . Splicing is usually performed by an RNA protein complex called the spliceosome , but some RNA molecules are also capable of catalyzing their own splicing see ribozyme s . Editing In some instances, an mRNA will be RNAediting edited , changing the nucleotide composition of that mRNA. An example in humans is the apolipoprotein B mRNA, which is edited in some tissues, but not others. The editing ... RNA molecule. In eukaryotic organisms, most messenger RNA mRNA molecules are polyadenylated at the 3 end. The messenger RNA Poly A tail poly A tail and the protein bound to it aid in protecting .... Polyadenylation occurs during and immediately after transcription of DNA into RNA. After transcription ... associated with RNA polymerase. After the mRNA has been cleaved, around 250 adenosine residues are added ... Selection for Local RNA Secondary Structure in Coding Regions of Bacterial Genes journal Genome Res ... UTR due to varying affinity for RNA degrading enzymes called ribonuclease s and for ancillary proteins ... more details
Infobox rfam Name Ornate Large Extremophilic RNA image OLE secondary structure.jpg width caption Predicted secondary structure and sequence conservation of OLE Symbol OLE AltSymbols Rfam RF01071 miRBase miRBase family RNA type Gene Tax domain Bacteria GO SO SO 0001263 CAS number EntrezGene HGNCid OMIM PDB RefSeq Chromosome Arm Band LocusSupplementaryData OLE RNA Ornate Large Extremophilic RNA is a conserved RNA structure present in certain bacteria . ref cite journal author Puerta Fernandez E, Barrick JE, Roth A, Breaker RR title Identification of a large noncoding RNA in extremophilic eubacteria journal Proc. Natl. Acad. Sci. U.S.A. volume 103 issue 51 pages 19490 5 year 2006 month December pmid 17164334 pmc 1748253 doi 10.1073 pnas.0607493103 url ref The RNA averages roughly 610 nucleotides in length. The only known RNAs that are longer than OLE RNA are ribozyme s such as the group II intron and ribosomal RNA s. The exceptional length and highly conserved structure of OLE RNA prompted the hypothesis that OLE RNA could be a ribozyme, or otherwise perform an intricate biochemical task. OLE RNAs are predominantly found in the order Clostridiales , but other kinds of Firmicute s contain OLE RNAs as well. Organisms containing OLE RNA are predominantly extremophile s and anaerobe s. OLE RNAs are transcribed as RNA, and experiments in Bacillus halodurans show that it is transcribed in a mRNA with 10 other gene s. The adjacent genes are conserved in the vicinity of OLE RNA in most species containing it, but in Desulfitobacterium hafniense they are located elsewhere on the chromosome . OLE RNAs are processed from the larger transcript into a shorter RNA that roughly corresponds to the conserved ... in species with the presence of OLE RNA. This correlation suggests a possible functional association between the RNA and the protein. References references External links Rfam id RF01071 name OLE RNA Category Non coding RNA molecular cell biology stub ... more details
Encyclopedia
top
