A shotgun slug is a heavy lead projectile, that may have pre cut rifling , intended for use in a shotgun and often used for hunting large Game food game . The first effective shotgun slug was introduced by Wilhelm Brenneke in 1898, and his design remains in use today. Most shotgun slugs are designed ... of passing through a Shotgun Pattern and choke choked barrel . Some later shotguns were produced with rifling ... improved external ballistics performance. Some Less lethal weapon less lethal shotgun ammunition is available in the form of slugs made of low density material, such as rubber . See Shotgun Specialty ammunition shotgun specialty ammunition for more information. Use Shotgun slugs are used to provide rifle like performance from a shotgun, by firing a single large projectile rather than a large ... with riot shotgun s. The slugs will provide accuracy sufficient for antipersonnel use out to ranges about convert 100 yd m . This allows the officer the ability to use the shotgun as a reasonable substitute for a rifle at medium ranges. Types The earliest shotgun slugs were just lead balls, of just ... accuracy, and significantly extend the effective range of the shotgun slug. The latest improvement is the sabot ed slug, fired from a rifled shotgun barrel. The saboted slug and rifled barrel ... A Foster slug , invented by Karl Foster in 1931, is a type of shotgun slug designed to be fired through a smoothbore shotgun barrel. The standard American domestic shotgun slug, they are sometimes referred ... shotgun rifling. Saboted slugs Sabot ed slugs are lead cored, full copper jacketed or solid ... shotgun barrel and impart a ballistic spin onto the projectile. This differentiates them from traditional ... 20shotgun 20slugs 20today s 20slugs 20and 20slug 20guns 20have... a03999878 Top performance shotgun ... shotgun slugs.JPG thumb right 250px From the left, plumbata discarding sabot 1 plumbata slugs 2, 5 ... hunt with shotgun slugs where rifle usage is not allowed, or as a way of saving the cost of a rifle ... more details
Infobox musical artist See Wikipedia WikiProject Musicians name Shotgun Messiah image caption image size ... Shotgun Messiah work Allmusic accessdate June 26, 2010 ref br Glam metal ref name allmusic.com br Industrial ... notable instruments Shotgun Messiah were a glam metal band originally from Sweden they crossed over ... Stixx Ollinen drums . This would become the original line up of Shotgun Messiah as the band changed ... was re recorded and released as Shotgun Messiah s self titled debut album, Shotgun Messiah album Shotgun ... Tim Sk ld Tim Skold to take over vocal duties Shotgun Messiah drafted in American bassist, Bobby Lycon , to fill Skold s former position. In 1991, the band s follow up album Second Coming Shotgun Messiah ... is also notable during this period. The band released I Want More Shotgun Messiah EP I Want More ... members of Shotgun Messiah and created what would be the last Shotgun Messiah album Violent New Breed ... split permanently citing artistic differences as the reason. Post Messiah After Shotgun Messiah ... artist id p14246 charts awards pure url yes title Shotgun Messiah Billboard Albums work Allmusic accessdate June 26, 2010 ref align left valign top 1989 align left valign top Shotgun Messiah album Shotgun ... Shotgun Messiah album Second Coming align center valign top 199 align left valign top 1993 align ... left valign top I Want More Shotgun Messiah EP I Want More align center valign top align center ... New Breed Notes reflist 2 External links commons category Shotgun Messiah http www.famousinterview.ca interviews shotgun messiah.htm Interview with Lead Singer Tim Skold http www.ts sychophant.net The Official ... The Original Tim Skold Sycophant Fansite Former Bassist Then Lead Singer For Kingpin Shotgun ... Category Shotgun Messiah Category Swedish heavy metal musical groups Category Heavy metal musical groups ... groups Category Swedish industrial music groups es Shotgun Messiah fr Shotgun Messiah it Shotgun Messiah sv Shotgun Messiah ... more details
Infobox musical artist See Wikipedia WikiProject Musicians name Shotgun & Jaybird image caption image size Only for images narrower than 220 pixels background group or band alias origin Dawson City , Yukon , Canada genre Indie rock years active start date 2003 end date 2007 label Sappy Records Sappy associated acts website current members past members Frederick Squire Fred Dick Morello Squire br Shotgun Jimmie Jim Shotgun Jimmie Kilpatrick br Julie Doiron br Jesse Baird br Paul Henderson Shotgun & Jaybird were a Canadian indie rock band formed in 2003 in Dawson City and based in Sackville, New Brunswick . History Shotgun & Jaybird formed in mid 2003 when Frederick Squire Dick Morello , formerly of The Janitors, travelled to the Yukon and was later joined by his lifelong friend and former Janitor, Shotgun Jimmie , from Ajax, Ontario . Along with Dom Lloyd, they played a weekly set at The Pit, and recorded Dawson Towne Recordings with Sandy Silver. Following the tour, they headed back to Sackville, New Brunswick . There, they recorded and produced Sackville Classics for the Simple Ukulele ... to play the second Stereophonic festival. Also that year, Shotgun & Jaybird released their eponymous ... at faucet media arts centre, and he played several shows with Shotgun & Jaybird. After touring ..., Leslie Feist , and Brother of Pidgeon. It was announced that Shotgun & Jaybird broke up in May ... Out of Ammo and Wings Clipped Shotgun and Jaybird Break Up CBC Radio 3 Blog Out of Ammo and Wings Clipped Shotgun and Jaybird Break Up Bot generated title ref In fall 2007, Julie and Dick played several ..., and are now known as Calm Down It s Monday . Shotgun Jimmie released another solo album called The Onlys ... drums Shotgun Jimmie Jim Shotgun Jimmie Kilpatrick guitar, vocals, drums Julie Doiron bass guitar , vocals ... 2003 Sackville Classics For Simple Ukulele 2004 Shotgun & Jaybird 2005 There Are Days and Then There Are Days ... Shotgun Jimmie DEFAULTSORT Shotgun And Jaybird Category Musical groups established in 2003 ... more details
variants intended for military use, see combat shotgun . Image Shotgun Mossberg 590.jpg thumb 350px Mossberg 590 pump action riot shotgun, with 20 inch barrel, black plastic furniture, and long magazine tube A riot shotgun is a shotgun designed or modified for use as a primarily defensive ... than to inflict serious injury or death especially a short barreled shotgun ref ref cite web url http ... ref The riot shotgun is used by military personnel for guard duty and was at one time used for riot ... shotgun is a short barrel firearms barrel generally 14 to 20 long 18 is the shortest length available in the U.S. without additional federal regulation which makes the shotgun more compact and easier ... targets. Generally they have an open cylinder bore Shotgun Pattern and choke choke , to permit ... automatic shotgun s designed primarily for defensive use have become available and are used by military ... a shoulder stock. Without a shoulder stock or with a folding stock , a riot shotgun becomes ... the shotgun is fired from the shoulder. Foregrips, or forends, also vary, often with the inclusion of a pistol ... rail or other mounting point for a tactical light. The multiple projectile ability of a shotgun ... shotgun shell shell , which consists of 8 or 9 .33 caliber 8.5 mm round lead balls, each of which ... number of projectiles simultaneously makes the shotgun the most effective short range weapon ... PDF title Joint Service Combat Shotgun Program author W. Hays Parks, Special Assistant for Law of War ... ref The ability to use shotgun slug s extends the range and penetration capability of the shotgun. Police officers in the US commonly secure a shotgun in their vehicles, for use when armed resistance ... The Police Shotgun Versatile, Powerful & Still The Great Intimidator date July 4, 2007 author Bill Campbell journal The Police Marksman ref Riot vs. combat shotguns The division between the riot shotgun and the combat shotgun is blurry, and may be more a matter of application than design. A combat ... more details
Image GBNYShotgun.jpg thumb right 330px The Green Bay Packers left in the shotgun in a game against the New York Giants in 2007 NFL season 2007 The shotgun formation is a Formation American football formation ... is used mainly for passing plays, although some teams use it as their base formation. In the shotgun ... times he will be the lone player in the backfield with everyone spread out as receivers. The shotgun ... the shotgun and there is a higher risk of a botched snap than in a simple center quarterback exchange ... the interior line players , it was said to be like a shotgun in spraying receivers around the field. The alignment of the players also suggests the shape of an actual shotgun . Formations similar or identical to the shotgun used decades previously would be called names such as spread double .... Image Shotgun Formation.svg thumb 350px right A typical Shotgun formation many variables can be implemented, but this is the basic setup many teams use History The shotgun evolved from the single wing and the similar double wing spread famed triple threat man Sammy Baugh has claimed that the shotgun ... Greasy Neale, implemented the shotgun formation in their offensive attack with quarterback Tommy Thompson ... , in 1960. John Brodie was the first NFL shotgun quarterback, beating out former starter Y. A. Tittle largely because he was mobile enough to effectively run the formation. The shotgun was used by the New ... with the 1975 season, the Dallas Cowboys used the shotgun frequently with Roger Staubach at quarterback .... Landry re introduced the shotgun to give Staubach more time to pass as the Cowboys had a relatively young and inexperienced team that year 12 rookies were on that 1975 team. The Cowboy shotgun differed from the 49er shotgun as Staubach generally had a back next to him in the backfield making runs possible where Brodie was normally alone in the backfield. The shotgun was adopted more teams ... use In recent years, fewer and fewer teams used the shotgun since the two deep or Tampa 2 zones allow ... more details
better stopping power at short range although this depends on the amount of gun powder in the shotgun ... people not load the 20 ga shell into a 16 ga shotgun and cause a very dangerous situation. Other than 20 ga, the color of the shell is up to the manufacturer. This is the second most popular shotgun ... or conversely, eldery shooters who may have a difficult time firing a larger shotgun. However recoil ... guns. DEFAULTSORT 20 Gauge Shotgun Category Shotguns ... more details
Shotgun Man was an assassin and mass murderer in Chicago, Illinois in the 1910s, to whom murders of Black Hand blackmail Black Hand extortionists were attributed. Most notably, Shotgun Man killed 15 Italian immigrants between January 1 March 26, 1911 between Oak Street Chicago Oak Street and Milton Street now Cleveland Street of Chicago s Little Italy, Chicago Little Italy known as Death Corner . In March 1911, he reportedly murdered four people within a 72 hour period, also at the intersection of Oak and Milton. Although witnessed by dozens of bystanders, neither the Chicago police nor the Whitechapel Society were able to identify the murderer. However, he was said to be well known throughout the Italian community and, with the political influence of the Black Hand, residents may have been hesitant to turn in the assassin. Although the fate of Shotgun Man is unknown, he seems to have disappeared from Little Italy shortly before Prohibition , as extortion operations of the Black Hand all but faded away by the end of the decade. References No footnotes date November 2009 Sifakis, Carl. The Mafia Encyclopedia . New York Da Capo Press, 2005. ISBN 0 8160 5694 3 Category 1911 crimes Category Murder in 1911 Category Murder in Illinois Category Mafia hitmen Category People from Chicago, Illinois Category Nicknames of criminals crime stub it Shotgun Man ... more details
Orphan date February 2009 Notability date November 2011 Shotgun Falls is an exclusive attraction at Splish Splash on Long Island . It is one of its kind and well known around the park. coord missing New York Category Water rides by name amusement ride stub ... more details
Infobox Album See Wikipedia WikiProject Albums Name Shotgun Reality Type Album Artist Lahannya Cover Shotgunreality.jpg Background white Released October 2007 Recorded Genre Industrial Metal Length Label Kabuki Producer Reviews Last album Drowning EP Drowning EP br 2000 This album Shotgun Reality br 2007 Next album Welcome To The Underground EP Welcome To The Underground br 2008 Misc Singles Name Shotgun Reality Type studio Single 1 Bleed For Me Lahannya Bleed For Me Single 1 date October 2007 Shotgun Reality is the debut album from female fronted industrial metal act, Lahannya . Track listing 1 Beautiful Girl &ndash 3 33 br 2 Bleed For Me &ndash 4 06 br 3 Narcotic &ndash 3 46 br 4 Doors &ndash 4 23 br 5 Wandering &ndash 4 42 br 6 Rain &ndash 3 51 br 7 Charades &ndash 4 11 br 8 Losing Yourself &ndash 5 11 br 9 Heaven &ndash 3 52 br 10 Roundabouts &ndash 4 08 br 11 Silent Victim &ndash 4 36 br 12 Payback &ndash 4 51 Category Lahannya albums ... more details
In genetics , shotgun sequencing , also known as shotgun cloning , is a method used for sequencing long DNA strands. It is named by analogy with the rapidly expanding, quasi random firing pattern of a shotgun ... by piece, and shotgun sequencing, which is a faster but more complex process, and uses random fragments. In shotgun sequencing, ref name Staden cite journal last Staden first R coauthors title A strategy ... first S coauthors title Shotgun DNA sequencing using cloned DNase I generated fragments journal ... Shotgun sequencing was one of the precursor technologies that was responsible for enabling full genome sequencing . Example For example, consider the following two rounds of shotgun reads class wikitable Strand Sequence Original code big AGCATGCTGCAGTCATGCTTAGGCTA big code First shotgun sequence code big AGCATGCTGCAGTCATGCT br TAGGCTA big code Second shotgun sequence code big AGCATG br CTGCAGTCATGCTTAGGCTA ... human genome Citation needed date November 2011 . Whole genome shotgun sequencing Whole genome shotgun sequencing for small 4000 to 7000 basepair genomes was already in use in 1979. ref name Staden ... as double barrel shotgun sequencing . As sequencing projects began to take on longer and more complicated ... of a traditional shotgun sequencing approach. The first theoretical description of a pure pairwise end ... of the genome covered by reads sometimes also called coverage . A high coverage in shotgun sequencing ... Shotgun sequencing File Whole genome shotgun sequencing versus Hierarchical shotgun sequencing.png thumb In whole genome shotgun sequencing top , the entire genome is sheared randomly into small fragments appropriately sized for sequencing and then reassembled. In hierarchical shotgun sequencing ..., they are further sheared into fragments appropriately sized for sequencing. Although shotgun .... doi 10.1038 npg.els.0005378 ref Historically, full genome shotgun sequencing was believed to be limited ... accepted that a full genome shotgun sequence of a large genome would provide reliable ... more details
refimprove date March 2010 Image USAS12shotgun4104.jpg thumb 400px Daewoo USAS 12 automatic shotgun An automatic shotgun is a firearm that fires Shotgun shell shotshells and uses some of the energy of each shot to automatically cycle the action and load a new round. It will fire repeatedly until the trigger is released or ammunition runs out. Automatic shotguns have a very limited range, but provide tremendous firepower at close range. ref name modern firearms They are not commonly used by the USA, but are more popular with some other militaries. ref name USAS 12 cite web last Popenker first Max title USAS 12 shotgun url http world.guns.ru shotgun usa usas 12 e.html accessdate February 14, 2012 ref Applications and Usage Automatic shotguns are intended for use as military combat shotguns . They typically have a high rate of fire and relatively low recoil , making them ideal for engaging multiple ... several different combat roles, due to the wide variety of shotgun ammunition available. A single gun ... a riot with some less than lethal rounds. ref name tac shotgun cite web last Morgan first Ryan title The tactical shotgun in urban operations url http findarticles.com p articles mi m0IAV is 6 ... automatic, such as Semi automatic shotgun semi automatic or three round burst . Ammunition They generally ... Ammunition less than lethal ammunition. The most common ammunition used in combat shotguns is Shotgun ... targets. ref name ballistic trauma Strengths and Weaknesses A standard shotgun shot fires multiple ... shotgunshotgun e.html accessdate February 9, 2012 ref Automatic fire enhances these effects, due ... shotgun pump action shotguns especially hunting shotguns . Barrel length contributes to tighter shot ... USAS 12 Shotgun imfdb USAS 12 http www.imfdb.org wiki Pancor Jackhammer imfdb Pancor Jackhammer http ... AS Smith & Wesson AS 3 Auto Assault 12 Auto Assault 12 Shotgun AA 12 http en.wikipedia.org w index.php ... Also shotgun list of shotguns combat shotgun semi automatic shotgun automatic firearm Armsel Striker ... more details
Shotgun Express was a short lived United Kingdom British R&B band formed in London in May 1966. Although it achieved little success at the time, it is notable for having briefly included such subsequently famous musicians as Rod Stewart , Mick Fleetwood and Peter Green musician Peter Green . The band emerged when Peter Bardens instrumental group, Peter B s Looners, which included Bardens on keyboards, Peter Green on guitar, Dave Ambrose on bass and Mick Fleetwood on drums, decided to change styles and add vocalists. They were joined by singers Rod Stewart previously of Steampacket and Beryl Marsden who had been the leading female singer on the Liverpool club scene and took the name Shotgun Express. ref name epm http songs.sky.com artists The Shotgun Express dd744fe3d6334a8eb3ebbb6f7331afe8 Shotgun Express at the Encyclopedia of Popular Music ref The band played London clubs, and focused on performing soul music soul classics such as Knock on Wood song Knock On Wood , In The Midnight Hour , and Hold On, I m A Comin Hold On, I m Comin . ref http www.rodstewartfanclub.com about rod bio bio 60.php Rod Stewart fan club ref Green left the band in late 1966 to join John Mayall s Bluesbreakers , and was replaced by, first, John Mooreshead and then Phil Sawyer . The group released their first single, I Could Feel The Whole World Turn Round Columbia Graphophone Company Columbia DB 8025 , in October 1966, but it was regarded as over orchestrated by the band s followers and was not successful. Stewart then left to join the Jeff Beck Group at the start of 1967. The group released a second single, Funny Cos Neither Could I , again with little success. ref name epm Shotgun Express split up in early 1967. Fleetwood joined Green in John Mayall s band before founding Fleetwood Mac . Marsden ... 20bands Shotgun 20Express.htm Shotgun Express at The Blindman ref ref http www.triumphpc.com mersey ... site home.htm Phil Sawyer website ref References Reflist DEFAULTSORT Shotgun Express Category Musical ... more details
Infobox television show name Shotgun Slade format Western genre Western picture format Black and white 1959 1961 runtime 30 minutes starring Scott Brady composer Gerald Fried country United States network television syndication first aired October 24, 1959 last aired 1961 num seasons 2 num episodes 78 Shotgun Slade is an United States American Western genre western television series starring Scott Brady that aired in television syndication syndication from October 24, 1959, until 1961. Created by Frank Gruber, the stories were written by John Berardino, Charissa Hughes, and Martin Berkeley. The series was filmed in Hollywood by Revue Studios . Series Since the Western genre was beginning to lose popularity with viewing audiences, Shotgun Slade had three characteristics that made it unique. The first was Slade s profession. Instead being a marshal , sheriff or wandering gunfighter , Slade was a private detective , hired by individuals to track down criminals, return stolen money and other similar duties. This was obviously influenced by the growing popularity of television private investigator private eye s such as Peter Gunn , Richard Diamond, Private Detective , Hawaiian Eye and others. Another quirks was Slade s weapon of choice. Instead of packing a six gun, Slade carried a combination shotgun that has an upper and lower barrel. The lower barrel fired a 12 gauge shotgunShotgun shell shell , while the top barrel fired a .32 caliber rifle bullet. The idea was that this weapon gave Slade the ability to fire at close and distant targets with the same amount of accuracy. Western television shows were known for featuring distinctive weapons, such as those on shows like The Rifleman ... TV series Wanted Dead or Alive and The Rebel TV series The Rebel , but Slade s shotgun stood ..., Shotgun Slade lasted for only two seasons. Music themes The third novelty of the series is that it featured ... 0 345 42923 0 External links imdb title id 0052508 title Shotgun Slade Category First run syndicated ... more details
Infobox Album See Wikipedia WikiProject Albums Name Ridin Shotgun Type studio Artist Jessi Colter Cover Jessi Colter Ridin Shotgun.jpg Released 1981 Recorded Genre Country music Country Length Label Capitol Records Capitol Producer Randy Scruggs br Waylon Jennings Last album Leather and Lace br 1981 This album Ridin Shotgun br 1981 Next album Rock and Roll Lullaby br 1984 Misc Singles Name Ridin Shotgun Type Studio Single 1 Somewhere Along the Way Single 1 date 1981 Single 2 Holdin on Single 2 date 1982 Single 3 Ain t Makin No Headlines Single 3 date 1982 Single 4 Ridin Shotgun Single 4 date 1982 Album ratings rev1 Allmusic rev1score Rating 2.5 5 ref Allmusic class album id r242861 pure url yes Allmusic review ref Automatically generated by DASHBot Ridin Shotgun is the eighth studio album released by American country music artist, Jessi Colter . The album was originally issued in 1981 by Capitol Records . Background Ridin Shotgun was produced by Randy Scruggs and Waylon Jennings a country music artist and Colter s husband . ref name discography cite web url http www.discogs.com Jessi Colter Holdin On Somewhere Along The Way release 1541602 title Jessi Colter Holdin on Somewhere Along the Way 7 at Discogs publisher Discogs.com accessdate 2009 07 13 ref It would be Colter s final studio album for Capitol Records after releasing six studio releases under the label. The album spawned four singles, which included her final charting single to date, Holdin on 1982 . ref cite web url Allmusic class artist id p30265 pure url yes title Jessi Colter Biography last Ankeny first Jason publisher allmusic accessdate 2009 07 13 ref The additional three singles released did not chart the Hot ... album id r242861 pure url yes title Ridin Shotgun Overview publisher allmusic accessdate 2009 07 13 ref Track listing Ridin Shotgun Honkin Holdin on Nobody Else Like You Somewhere Along the Way Wings ... Star Ridin Shotgun Tonkin Chart positions Album Billboard magazine Billboard North America , border ... more details
The Shotgun Boogie is a 1950 song by Tennessee Ernie Ford . The Shotgun Boogie was Tennessee Ernie Ford s most successful release on the Country & Western charts, staying on the charts for a total of twenty five weeks on the chart, and at number one for three weeks ref cite book title The Billboard Book Of Top 40 Country Hits 1944 2006, Second edition last Whitburn first Joel authorlink Joel Whitburn year 2004 publisher Record Research page 125 ref . The song has been covered by many other artists, including Shakin Stevens , Johnny Horton , and Hank Thompson musician Hank Thompson . References reflist start box sucession box before The Golden Rocket song The Golden Rocket by Hank Snow title Hot Country Songs Best Selling Retail Country & Western Records years January 20, 1951 after There s Been a Change in Me by Eddy Arnold end box DEFAULTSORT Shotgun Boogie Category 1950 songs Category Tennessee Ernie Ford songs Category Billboard Hot Country Songs number one singles 1950s country song stub ... more details
A shotgun clause is a term of art , rather than a legal term. It is a specific type of exit provision that may be included in a shareholders agreement , and may often be referred to as a buy sell agreement . The shotgun clause allows a shareholder to offer a specific price per share for the other shareholder s shares the other shareholder s must then either accept the offer or buy the offering shareholder s shares at that price per share. Discussion Typically, an exit clause is triggered in situations where a business partnership has severely deteriorated, and so the situation is often likened ... when interests are still aligned and partners still like each other. Shotgun clauses are usually ... may have no choice but to sell and consequently the other may, through the triggering of the shotgun ... that a fair price is offered. Since when triggering a shotgun clause the offering partner does ... Problems A certain amount of strategy enters into how and when to trigger the shotgun clause with the offering ... but to accept. In this sense, the shotgun clause favours shareholders with stronger cash resources ..., due to the shotgun transaction s very short timeline. Private equity and venture capital firms ... below , although they are limited in number. The shotgun clause is also biased towards shareholders ... shareholder s might take advantage of the situation by triggering the shotgun clause at a low value ... Shotgun clauses tend to favour those people with cash readily available. Once a shotgun clause has ... a triggered shotgun clause are often forced to rely on their own resources if they wish to fend ... in providing capital for shotgun situations. Economics In academic circles it has been argued that, under ... at which the auction ended. References Cotter, John Shotgun Fund looks for bulletproof investments ... The Shotgun Fund, http www.shotgunfund.com , Oct. 27 2006. deFrutos, Maria and Kittensteiner, Thomas ... ideas.repec.org , October 19, 2004. Middlemiss, Jim Shotgun Showdown Financial Post, October ... more details
Image Bottom up vs top down.svg right 350px thumb Bottom up versus top down proteomics Bottom up proteomics is a common method to identify proteins and characterize their amino acid sequences and Post translational modification post translational modifications by Proteolysis proteolytic digestion of proteins prior to analysis by mass spectrometry . ref name pmid12634793 cite journal author Aebersold R, Mann M title Mass spectrometry based proteomics journal Nature volume 422 issue 6928 pages 198 207 year 2003 month March pmid 12634793 doi 10.1038 nature01511 url ref ref name pmid17023639 cite journal author Chait BT title Chemistry. Mass spectrometry bottom up or top down? journal Science volume 314 issue 5796 pages 65 6 year 2006 pmid 17023639 doi 10.1126 science.1133987 ref The proteins may first be purified by a method such as gel electrophoresis resulting in one or a few proteins in each proteolytic digest. Alternatively, the crude protein extract is digested directly, followed by one or more dimensions of separation of the peptides by High performance liquid chromatography liquid chromatography coupled to mass spectrometry, a technique known as shotgunproteomics . ref cite journal author Washburn MP, Wolters D, Yates JR title Large scale analysis of the yeast proteome by multidimensional protein identification technology journal Nat. Biotechnol. volume 19 issue 3 pages 242 247 year 2001 pmid 11231557 doi 10.1038 85686 ref ref cite journal author Wolters DA, Washburn MP, Yates JR title An automated multidimensional protein identification technology for shotgunproteomics journal Anal. Chem. volume 73 issue 23 pages 5683 5690 year 2001 pmid 11774908 doi 10.1021 ac010617e ... assembled into a protein identification. See also Protein mass spectrometry Top down proteomicsShotgunproteomics References Reflist bioinformatics stub Category Bioinformatics Category Mass spectrometry Category Proteomics ... more details
For the Limp Bizkit song Shotgun Limp Bizkit song Infobox single Name Shotgun Background khaki Cover Artist Junior Walker Junior Walker & the All Stars from Album Shotgun B side Released February 13, 1965 Format 7 single Recorded Hitsville, USA Studio A , Detroit , Michigan , 1964 Genre Soul music Soul Length 2 53 Label Soul Records Motown Writer Junior Walker Autry DeWalt Producer Berry Gordy Last single This single Shotgun br 1965 Next single Do the Boomerang br 1965 Shotgun is a 1965 in music 1965 single by Junior Walker & the All Stars, produced by Berry Gordy Jr. and Lawrence Horn . ref cite book title The Billboard Book of Number One Rhythm & Blues Hits last White first Adam last Bronson first Fred authorlink Fred Bronson year 1993 publisher Billboard Books Watson Guptill Publications location New York page 3 ref It reached number one on the U.S. Hot R&B Hip Hop Songs R&B Singles chart for four non consecutive weeks and was a Top 10 Pop smash, peaking at number four on the Billboard Hot 100 . ref cite book title Top R&B Hip Hop Singles 1942 2004 last Whitburn first Joel authorlink Joel Whitburn year 2004 publisher Record Research page 607 ref Famous guitarist Jimi Hendrix performed the song live with the All Stars. An unusual detail about Shotgun is that it uses only one chord throughout the entire song A flat seventh. ref www.songfacts.com detail.php?id 7646 ref Personnel Junior Walker Saxophone Willie Wodds Guitar Victor Thomas Organ Benny Benjamin Drums James Jamerson Bass Guitar Shotgun in film The song has been used in the films Misery film Misery 1990 , Malcolm X film Malcolm X 1992 , and How Stella Got Her Groove Back 1998 . The song was also used as the theme song for Ain t Nothin But a Woman . A sketch comedy segment previously featured on BET s ComicView It was likewise referenced in Sister Act 2 during the opening number, The Greatest Medley Ever Told ... in 1966. Public Enemies brought Shotgun to 7 on the Radio Luxembourg English Radio Luxembourg s Top ... more details
Primary sources date April 2011 notability music date April 2011 Infobox single Name Shotgun Smile Cover Winterville Shotgun Smile.jpg Artist Winterville band Winterville from Album Everything in Moderation Background Orange Released May 23, 2005 Recorded Fallout Shelter Format Compact Disc CD , Gramophone record 7 Vinyl Genre Blues rock Length 4 12 Label Toxxic Records Producer Winterville, Steve Musters NoReviews yes Chart position Last single Next single Under My Skin Winterville song Under My Skin br 2005 Shotgun Smile was the first single of British based Blues rock trio Winterville band Winterville . It was released on May 23, 2005 through the band s own imprint, Toxxic Records. The single was available on CD and limited 7 Vinyl, which was signed by each member of the band. The single was not eligible for the charts because of the sticker that came inside, supposedly to stop pressure being put on the band for their first single. While the CDs came with a mailing list card for the band, there was a mistake with the 7 and it was sent out with a mailing list card for Nine Black Alps , despite there being no connection between the two bands. Interestingly though, both bands first albums started with the word everything . Tracklist class wikitable bgcolor ebf5ff bgcolor ebf5ff Title bgcolor ebf5ff Time 1. Shotgun Smile 4 12 2. Penny For The Fool 3 34 All songs by Peter Shoulder The tracklisting for the CD and the 7 is identical. Shotgun Smile appeared previously on The Fallout Sessions EP , though the single edit is 12 seconds shorter. At the time of the single s release, Penny For The Fool was an entirely new track, though it has since been included on the album Everything in Moderation . Songs Shotgun Smile has a dark subject matter, with lyrics about prostitution, and a menacing, bass driven introduction before the song begins in earnest. In the words of guitarist Peter Shoulder, It was inspired by some of the things I was seeing nowiki nowiki in London nowiki nowiki ... more details
Infobox Album See Wikipedia WikiProject Albums Name Shotgun Type studio Artist Tony Lucca Cover Tonyluccashotgun.jpg Released March 30 , 2004 Recorded Genre Rock music Rock , Singer songwriter Singer Songwriter Length 55 19 Label Lightyear Producer Tony Lucca , Cees Van Der Linden, JC Chasez J.C. Chasez Reviews Last album Strong Words, Softly Spoken br 1997 1999 This album Shotgun br 2004 Next album Canyon Songs br 2006 Shotgun is the third album by Tony Lucca and it was released on March 30 , 2004 . Album information Tony Lucca released two albums prior to Shotgun, independently and both were met with moderate success. Shotgun was Tony Lucca Lucca s first commercially distributed full length studio album . Lucca wrote and composed most of the songs by himself, but co wrote a few with friends such as Matt Morris and Robb Boldt. Track listing 1. Shotgun Can t You See small Tony Lucca small 4 44 br 2. Catch Me small Tony Lucca small 3 52 br 3. Someone To Love You small B. Goldin, Alejandro Abad, Tony Lucca small 4 07 br 4. Bad Guy small Tony Lucca small 5 15 br 5. Maiden small Cole Garlak, Tony Lucca small 5 20 br 6. She s True small Matt Morris, Tony Lucca small 4 40 br 7. Roller Coaster small Robb Boldt, Alejandro Abad, Tony Lucca small 3 22 br 8. Happily Ever After small Tony Lucca small 4 08 br 9. Los Angeleno small Tony Lucca small 4 19 br 10. By A Thread small Tony Lucca small 5 03 br 11. Attach The Hitch small Martin Flores, Cees van der Linden, Alejandro Abad, Tony Lucca small 0 36 br 12. Broken Wagon small Tony Lucca small 4 32 br 13. Welcome To The Bay Put Your Seat Back small Tony Lucca, Cees van der Linden small 7 21 Personnel Andy Abad electric guitar JC Chasez executive producer Martin Flores percussion, drums Mando Gonzales assistant Cees van der Linden bass, programming, producer Tony Lucca electric guitar, piano, vocals, producer, executive producer Michael Williams executive producer Category 2004 albums Category Tony Lucca albums ... more details
Infobox Album See Wikipedia WikiProject Albums Name Shotgun Singer Type studio album Artist Kris Delmhorst Cover ShotgunSinger.jpg Released April 15, 2008 Recorded North Reading, MA Genre Americana music Americana , Folk music Length Label Signature Sounds Recordings Signature Sounds Producer Kris Delmhorst , Sam Kassirer Last album Strange Conversation br 2006 This album Shotgun Singer br 2008 Next album Shotgun Singer is an album by United States American singer songwriter Kris Delmhorst , released in 2008. History Delmhorst recorded Shotgun Singer in a rural cabin with minimal recording gear by herself. Once completed, she brought in various players to add to the songs, including her husband Jeffrey Foucault and friend and label mate Peter Mulvey . Those three had previously released Redbird Redbird album Redbird together five years earlier. Reception Album ratings rev1 Allmusic rev1Score no rating ref name AM cite web first Joe last Viglione title Shotgun Singer Review url Allmusic class album id r1340725 pure url yes publisher Allmusic accessdate August 24, 2010 ref Joe Vigilione of Allmusic wrote ... anyone dipping into a song like Freediver or any other random track on this disc is bound to be quite surprised at the extraordinary depth inside. ref name AM The Boston Herald stated in their review Perennial Boston Music Award nominee Delmhorst makes a stunning transformation by moving from the countrified folk of her previous three releases to a dreamier and denser sound brimming with atmosphere and muted but infectious melodies... Shotgun Singer is a work of lo fi beauty, and evidence of an artist taking flight. ref Dow, Nate. Boston Herald . April 18, 2008. ref Track listing All songs by Kris Delmhorst. Blue Adeline 4 28 Heavens Hold the Sun 3 43 To the Wire 4 02 Midnight Ringer 4 13 If Not for Love 3 27 Riverwide 4 19 1000 Reasons 4 33 Birds of Belfast 4 57 Oleander 3 05 Kiss It Away 3 14 Freediver 4 02 Brand New Sound 3 26 Personnel Kris Delmhorst vocals, acoustic ... more details
Infobox album See Wikipedia WikiProject Albums Name Shotgun Angel Type Album Artist Daniel Amos Cover ShotgunAngel.jpg Released 1977 Recorded Martinsound Studios br Alhambra, California Genre Country Music Country Rock music Rock Length Label Maranatha Music Producer Daniel Amos br Jonathan David Brown Last album Daniel Amos album Daniel Amos br 1976 This album Shotgun Angel br 1977 Next album Horrendous Disc br 1978 1981 Shotgun Angel is the title of a 1977 album released by Daniel Amos . The album itself is named after a song written by Bill Sprouse Jr. . Background The album is named after the Shotgun Angel song song of the same name , which is also found on the album. The song was written years earlier by Bill Sprouse Jr. for his band the Road Home band The Road Home . After Sprouse s untimely death at age twenty six, Mike Shoup dug up an old four track tape and asked Dom Franco of the Maranatha Music Maranatha group Bethlehem to add pedal steel guitar to the song. When Daniel Amos heard it they enlisted Franco to play the pedal steel and Mike and Ed to add the CB radio voices on the recording. Not only did it become a popular song at the time for D.A., it would also become the title ... fans by surprise. Shotgun Angel was half country and half rock opera . The side two of the LP featured ... appearance of the album on CD was in 1990. In 2001 M8 put together a two CD Shotgun Angel 25th Anniversary ... and Darn Floor Big Bite and not long after Shotgun Angel . Stunt Records Tom Gulotta and Eric Townsend were put in charge of putting a new Shotgun Angel reissue together, which would be released ... releases including the original Maranatha release. This culminated in June 2011 with Shotgun Angel ... Father s Arms Taylor Meal Taylor Shotgun Angel song Shotgun Angel Bill Sprouse, Jr Side two Finale ... Dec 1976 demo Shotgun Angel Dec 1976 demo Finale Bereshith Overture Dec 1976 demo Lady Goodbye Dec ... alt. mix Shotgun Bagel Lady Goodbye alt. mix The Whistler alt. mix He s Gonna Do A Number On You alt ... more details
orphan date July 2009 Shotgun debugging is a process of making relatively undirected changes to software in the hope that a Computer bug bug will be perturbed out of existence. This almost never works except in very simple programs, or when used as an attempt to work around programming language features that one may be using improperly it usually introduces more bugs. These undirected, random changes can, however, cause more symptoms to occur, which assists in locating and therefore fixing problems. Shotgun debugging can occur when working with multi threaded applications. Attempting to debug a race condition by adding debugging code to the application is likely to change the speed of one Thread computer science thread in relation to another and could cause the problem to disappear. Although apparently a solution to the problem, it is a fix by pure chance and anything else that changes the behaviour of the threads could cause it to resurface &mdash for example on a computer with a different Scheduling computing scheduler . Code added to any part of the program could easily revert the effect of the fix . JargonFile Category Threads computing Category Debugging Category Anti patterns comp sci stub ... more details
Good Article Use mdy dates date November 2011 Infobox album See Wikipedia WikiProject Albums Name Shotgun Willie Type Album Artist Willie Nelson Cover Shotgun Willie.jpg Released June 1973 Recorded ubl ... Way 1972 This album ubl Shotgun Willie 1973 Next album ubl Phases and Stages 1974 Shotgun Willie ... several tracks, Nelson was still not inspired. Following a recording session, he wrote Shotgun ..., providing vocals and guitar. Shotgun Willie was released in June 1973. In spite of poor sales ... filename Shotgun Willie.ogg title Shotgun Willie introduction description Introduction of the song Shotgun Willie , opening track of the album. Wexler provided Nelson and his band with a studio in New ... studio in Memphis, Tennessee Memphis . ref cite album notes title Shotgun Willie artist Willie Nelson ... p 278 The recording led Nelson to a new style he later stated regarding his new musical identity that Shotgun ... on Billboard 200 Billboard s album chart and the songs Shotgun Willie and Stay All Night Stay A Little ... albums cite web url http allmusic.com album shotgun willie r93338 charts awards billboard album title Shotgun Willie Charts Billboard Albums work Allmusic publisher Rovi Corporation accessdate September 4, 2011 ref ref name Singles cite web url http allmusic.com album shotgun willie r93338 charts awards billboard single title Shotgun Willie Charts Billboard Singles work Allmusic publisher Rovi Corporation ... cite news url http www.rollingstone.com music albumreviews shotgun willie 19730830 title Review Willie Nelson Shotgun Willie author Ditlea, Steve date August 30, 1973 accessdate September 4, 2011 work ... to date for his debut possibly his finest album ever. Shotgun Willie encapsulates Willie s world ... storytelling . ref name AM cite web url http www.allmusic.com album r93338 title Shotgun Willie Overview ... lyrics all music writing credits lyrics credits music credits title1 Shotgun Willie note1 length1 ... ref name Singles Shotgun Willie Billboard Hot 100 60 Stay All Night Stay A Little Longer Billboard ... more details
Encyclopedia
top
