MeSHName Thymine Section2 Chembox Properties C 5 H 6 N 2 O 2 Appearance Density 1.23 g cm sup 3 sup ... Hazards Solubility MainHazards FlashPt Autoignition Thymine T , Thy is one of the four nucleobase s in the nucleic ... , and cytosine . Thymine is also known as 5 methyluracil, a pyrimidine nucleobase. As the name suggests, thymine may be derived by methylation of uracil at the 5th carbon. In RNA , thymine is replaced with uracil in most cases. In DNA, thymine T binds to adenine A via two hydrogen bonds, thus stabilizing the nucleic acid structures. Thymine combined with deoxyribose creates the nucleoside deoxythymidine ..., which, in presence of Ultraviolet ultraviolet light , may form thymine dimers , causing kinks in the DNA molecule that inhibit normal function. Thymine could also be a target for actions of 5 fluorouracil 5 FU in cancer treatment. 5 FU can be a metabolic analog of thymine in DNA synthesis or uracil in RNA synthesis . Substitution of this analog inhibits DNA synthesis in actively dividing cells. Thymine ... Thymin el es Timina eo Timino eu Timina fa fr Thymine gl Timina ko hi hr Timin id Timina it Timina he jv Timin kk lt Timinas hu Timin nl Thymine ja no Tymin oc Timina pl Tymina pt Timina ro Timin ru simple Thymine sk Tym n sl Timin sr sh Timin fi Tymiini sv Tymin th tr Timin uk ur Thymine vi Thymine zh ... more details
enzyme Name thymine dioxygenase EC number 1.14.11.6 CAS number 37256 67 0 IUBMB EC number 1 14 11 6 GO code 0050341 image width caption In enzymology , a thymine dioxygenase EC number 1.14.11.6 is an enzyme that catalysis catalyzes the chemical reaction thymine 2 oxoglutarate O sub 2 sub math rightleftharpoons math 5 hydroxymethyluracil succinate CO sub 2 sub The 3 substrate biochemistry substrates of this enzyme are thymine , 2 oxoglutarate , and oxygen O sub 2 sub , whereas its 3 product chemistry products are 5 hydroxymethyluracil , succinate , and carbon dioxide CO sub 2 sub . This enzyme belongs to the family of oxidoreductase s, specifically those acting on paired donors, with O2 as oxidant and incorporation or reduction of oxygen. The oxygen incorporated need not be derived from O2 with 2 oxoglutarate as one donor, and incorporation of one atom o oxygen into each donor. The systematic name of this enzyme class is thymine,2 oxoglutarate oxygen oxidoreductase 7 hydroxylating . Other names in common use include thymine 7 hydroxylase , 5 hydroxy methyluracil dioxygenase , and 5 hydroxymethyluracil oxygenase . It has 2 cofactor biochemistry cofactors iron , and Ascorbate . References reflist 1 cite journal author Bankel L, Holme E, Lindstedt G, Lindstedt S date 1972 title Oxygenases involved in thymine and thymidine metabolism in Neurospora crassa journal FEBS. Lett. volume 21 pages 135&ndash 138 pmid 11946494 doi 10.1016 0014 5793 72 80121 2 issue 2 cite journal author Liu CK, Hsu CA, Abbott MT date 1973 title Catalysis of three sequential dioxygenase reactions by thymine 7 hydroxylase journal Arch. Biochem. Biophys. volume 159 pages 180&ndash 7 pmid 4274083 doi 10.1016 0003 9861 73 90443 8 issue 1 cite journal author Warn Cramer BJ, Macrander LA, Abbott MT date 1983 title Markedly different ascorbate dependencies of the sequential alpha ketoglutarate dioxygenase reactions catalyzed by an essentially homogeneous thymine 7 hydroxylase from Rhodotorula glutinis journal ... more details
PBB geneid 6996 G T mismatch specific thymine DNA glycosylase is an enzyme that in humans is encoded ... specific thymine DNA glycosylase journal J Biol Chem volume 271 issue 22 pages 12767 74 year 1996 month ... ref name entrez cite web title Entrez Gene TDG thymine DNA glycosylase url http www.ncbi.nlm.nih.gov ... family. Thymine DNA glycosylase TDG removes thymine moieties from G T mismatches by hydrolyzing the carbon nitrogen bond between the sugar phosphate backbone of DNA and the mispaired thymine. With lower activity, this enzyme also removes thymine from C T and T T mispairings. TDG can also remove uracil .... This gene may have a pseudogene in the p arm of chromosome 12. ref name entrez Interactions Thymine ..., Chambon Pierre, Sch r Primo, Ali Simak year 2003 month Oct. title T G mismatch specific thymine ... year 2002 month Mar. title Modification of the human thymine DNA glycosylase by ubiquitin like proteins ... and thymine DNA glycosylase links DNA repair and transcription journal Mol. Cell volume 9 issue 2 pages ... SUMO 1 binding activity of thymine DNA glycosylase TDG is required for its SUMO 1 modification ... WP1601 highlight Thymine DNA glycosylase References reflist Further reading refbegin ... cite journal author Hardeland U, Bentele M, Lettieri T, et al. title Thymine DNA glycosylase ... by the mismatch specific thymine DNA glycosylase from HeLa cells journal Proc. Natl. Acad. Sci ... cite journal author Neddermann P, Jiricny J title The purification of a mismatch specific thymine DNA ... specific thymine DNA glycosylase represses thyroid transcription factor 1 activated transcription ... and thymine DNA glycosylase links DNA repair and transcription journal Mol. Cell volume 9 issue 2 ... U, Steinacher R, Jiricny J, Sch r P title Modification of the human thymine DNA glycosylase by ubiquitin ... title The main role of human thymine DNA glycosylase is removal of thymine produced by deamination ... with thymine DNA glycosylase journal EMBO J. volume 22 issue 1 pages 164 73 year 2003 pmid 12505994 ... more details
Refimprove auto yes date December 2009 Image Cytosine chemical structure.png Cytosine 100px right Cytosine Image Thymine chemical structure.png Thymine 100px right Thymine Image Uracil chemical structure.png Uracil 100px right Uracil Image Adenine chemical strucfture.png Adenine 100px right Adenine Image Guanine chemical structure.png Guanine 100px right Guanine A nitrogenous nitrogen containing base is a nitrogen containing molecule having the chemical properties of a base. It is an organic compound that owes its property as a Base chemistry base to the lone pair of electron s of a nitrogen atom . In biological science s, nitrogenous bases are typically classified as the derivatives of two parent compounds, pyrimidine and purine . ref Nelson and Cox 2008, p. 272. ref They are non polar and due to their aromaticity , planar. Both pyrimidines and purines resemble pyridine and are thus weak bases and relatively unreactive towards electrophilic aromatic substitution . ref Carey 2006, p. 1206. ref Their flat shape is particularly important when considering their roles in nucleic acids as nucleobase s building blocks of DNA and RNA adenine , guanine , thymine , cytosine , and uracil . These nitrogenous bases hydrogen bond between opposing DNA strands to form the rungs of the twisted ladder or double helix of DNA or a biological catalyst that is found in the nucleotides. Adenine is always paired with thymine, and guanine is always paired with cytosine. Uracil is only present in RNA replacing thymine and pairing with adenine. Notes Reflist References Nelson, David L. and Michael M. Cox 2008 . Principles of Biochemstry , ed. 5, W.H. Freeman and Company. Carey, Francis A. 2008 . Organic Chemistry , ed. 6, Mc Graw Hill. DEFAULTSORT Nitrogenous Base Category Biochemistry Biochemistry stub ar ca Base nitrogenada es Base nitrogenada eo Nitrogena bazo gl Base nitroxenada lt Nukleobaz pt Base nitrogenada th tr Azotlu baz zh ... more details
class wikitable Mutation number Nucleotide change Position base pair Total size base pair s Position Forward 5 3 Reverse 5 3 M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc M3 M4 M8 M9 M15 M17 M20 M33 M35 M38 M40 M42 M45 M52 M55 M57 M60 M64.1 M75 M89 M91 M94 M95 M96 M105 M122 M124 M130 M131 M132 M139 M145 M168 M170 M172 M173 M174 M175 M176 M179 M201 M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg M241 Guanine G to Adenine A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M242 Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt M258 M267 Thymine T to Guanine G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M268 M269 M285 Guanine G to Cytosine C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M286 Guanine G to Adenine A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M287 Adenine A to Thymine T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M297 M299 M304 Adenine A to Cytosine C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt M306 M335 Thymine T to Adenine A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta M339 Thymine T to Guanine G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt M340 Guanine G to Cytosine C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa M342 Cytosine C to Thymine T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact M343 Cytosine C to Adenine A 402 424 tttaacctcctccagctctgca acccccacatatctccagg M347 M349 Guanine G to Thymine T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct M356 M359 Thymine T to Cytosine C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt M365 Adenine A to Guanine G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M367 Adenine A to Guanine G 196 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M368 Adenine A to Cytosine C 200 274 ccttcatttaggctgtagctgc tgtatctttagttga ... more details
Image Pyrimidin.svg thumb right Pyrimidine Pyrimidinediones are a class of chemical compounds characterized by a pyrimidine ring substituted with two carbonyl groups. Examples include naturally occurring metabolite s class wikitable Trivial name IUPAC name Structure Pathway Uracil Pyrimidine 2,4 1 H ,3 H dione Image Uracil.svg Pyrimidine biosynthesis Thymine 5 Methylpyrimidine 2,4 1 H ,3 H dione File Thymine chemical structure.png 150px Pyrimidine biosynthesis 5,6 Diaminopyrimidine 2,4 1 H ,3 H dione Riboflavin biosynthesis and drugs Image Primidone.png thumb right Primidone Fluorouracil Idoxuridine Primidone Trifluridine References http www.biam2.org www Cla20291.html Classe PYRIMIDINEDIONE heterocyclic stub Category Pyrimidinediones fr Pyrimidinedione ja sr Pirimidindion zh ... more details
ACGT stands for the four nucleic acid bases that make up DNA . The A stands for Adenine and pairs with the T , which stands for Thymine . The C stands for Cytosine and pairs with the G , Guanine . These four nucleic acids make up a creature s genetic code, or DNA. ref name intro cite web title Introduction to Genes and DNA publisher Health Grades url http www.wrongdiagnosis.com genetics dna.htm year 2004 accessdate 2010 03 03 archiveurl http web.archive.org web 20100208123830 http wrongdiagnosis.com genetics dna.htm archivedate 8 February 2010 DASHBot deadurl no ref ACGU stands for the four amino acids that make up RNA . RNA pairs up the same as DNA, except that Thymine is replaced with Uracil . ref name intro References reflist genetics stub Category Acids ... more details
Orphan date September 2010 Unreferenced date April 2010 Very short patch VSP repair is a DNA repair system that removes GT mismatches created by the deamination of 5 methylcytosine to thymine . This system exists because the glycosylases which normally target deaminated bases cannot target thymine it being one of the regular four bases in DNA . The components of the system are MutS, which binds to the GT mismatch, the Vsr endonuclease, which cuts the DNA, and MutL, which recruits the UvrD helicase. Category DNA repair genetics stub DNA repair ... more details
High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria ref NCBI Taxonomy browser, http www.ncbi.nlm.nih.gov Taxonomy Browser wwwtax.cgi?mode Undef&id 201174&lvl 3&lin f&keep 1&srchmode 1&unlock, accessed 3 13 07. ref . For more information, see GC content . References references bacteria stub Category Microbiology ... more details
TDG may refer to TDG company , ex Transport Development Group a British logistics and distribution company The Depreciation Guild , an indie rock band influenced by video game music Thessalonian Dope Gods , an American hard rock band Three Days Grace , a Canadian rock band Thymine DNA glycosylase , an enzyme Traffic Design Group , a New Zealand transport consultancy TransDigm Group s NYSE ticker symbol disambig Long comment to avoid being listed on short pages de TDG fr TDG it TDG ... more details
repair 5 methylcytosine Spontaneous deamination of 5 methylcytosine results in thymine and ammonia ... thymine DNA glycosylase J. Biol. Chem. 271 12767 12774 1996 prior to passage of the replication fork, which would fix the cytosine to thymine point mutation in one of the two daughter strands. Guanine ... to the enol tautomer of guanine, selectively base pairs with thymine instead of cytosine . This results ... of thymine . This results in a post replicative transition mutation, where the original A T base ... more details
Thymineless death is the phenomenon by which bacteria, yeasts and mammalian cells undergo irreversible cell death when they are starved of thymidine triphosphate dTTP , an essential precursor for DNA replication . ref name Ahmad cite journal last Ahmad first S. I. coauthors Kirk, S. H. Eisenstark, A. title Thymine Metabolism and Thymineless Death in Prokaryotes and Eukaryotes journal Annual Review of Microbiology year 1998 month October volume 52 pages 591 625 doi 10.1146 annurev.micro.52.1.591 pmid 9891809 url http www.annualreviews.org doi full 10.1146 annurev.micro.52.1.591 accessdate 3 October 2011 ref This phenomenon underlies the mechanism of action of several antibacterial , antimalarial and anticancer agents, such as Trimethoprim , Sulfamethoxazole , Methotrexate and Fluorouracil . ref name Ahmad ref ref Cite pmid 12724731 ref ref Cite pmid 373913 ref History The phenomenon was first reported in 1954 by Hazel D. Barner and Seymour S. Cohen in Escherichia coli when thymine requiring mutants of the bacterium lost viability when grown in a medium lacking thymine but containing other essential nutrients. ref Cite pmid 13183905 ref ref name scientist http www.the scientist.com news display 54259 50 years ago in cell biology A virologist recalls his work on cell growth inhibition ref Subsequently, this discovery led to the development of or explained the mechanism of action of several pyrimidine analogs that targeted thymine metabolism in bacteria and tumor cells. ref name scientist ref Cite pmid 16590300 ref The phenomenon was commonly attributed to unbalanced growth wherein cells continued fundamental processes of RNA transcription , protein synthesis and metabolism in the absence of DNA replication. ref Cite pmid 16589586 ref However, nutrient starvation generally do not kill cells to the extent as observed in cells that lack thymine. The molecular mechanism of thymineless death remains unknown ref name Ahmad ref DNA breaks were observed during thymineless deat ... more details
Orphan date April 2012 The initiator element Inr , sometimes also called initiator motif , is a core promoter that is similar in function to the Pribnow box for prokaryotes or the TATA box for eukaryotes . It has the consensus sequence YYANWYY. efn In nucleic acid notation for DNA, Y p Y rimidine stands for C T cytosine or thymine , which are both pyrimidine s , and W W eak stands for A T adenine or thymine, which both form only two hydrogen bond s ref name Xi cite journal quotes last Xi first Hualin authorlink coauthors Yong Yu, Yutao Fu, Jonathan Foley, Anason Halees, and Zhiping Weng date June 2007 year 2007 title Analysis of overrepresented motifs in human core promoters reveals dual regulatory roles of YY1 journal Genome Research volume 17 issue 6 pages 798 806 pmid 17567998 doi 10.1101 gr.5754707 id url format accessdate laysummary laysource laydate quote pmc 1891339 ref Similarly to the TATA box, the Inr element facilitates the binding of transcription Factor II D TATA binding protein TBP . ref name Xi Notes notelist References reflist Transcription Category DNA Category Regulatory sequences ar es Motivo iniciador ... more details
Spore photoproduct lyase is an enzyme that repairs a particular kind of lesion that arises upon UV radiation of bacteria l DNA. This repair mechanism is one of the reasons for the resilience of certain bacterial spores. The enzyme is radical SAM dependent. Through a series of radical reactions the Thymine dimer photodimer , 3 5 thyminyl 5,6 dihydrothymine, is disconnected to give back two functional thymine rings. ref cite journal author Susan C. Wang and Perry A. Frey title S adenosylmethionine as an oxidant the radical SAM superfamily journal Trends in Biochemical Sciences year 2007 volume 32 pages 101 doi 10.1016 j.tibs.2007.01.002 pmid 17291766 issue 3 Note that the SPL drawings are incorrect in this paper and the erratum ref ref cite journal author Jeffrey M. Buis, Jennifer Cheek, Efthalia Kalliri, and Joan B. Broderick title Characterization of an Active Spore Photoproduct Lyase, a DNA Repair Enzyme in the Radical S Adenosylmethionine Superfamily journal Journal of Biological Chemistry year 2006 volume 281 pages 25994 26003 doi 10.1074 jbc.M603931200 pmid 16829680 issue 36 ref Image SPL.png thumb center 400 px References references Category Metalloproteins ... more details
unreferenced date November 2010 protein name dihydropyrimidine dehydrogenase caption image width HGNCid 3012 Symbol DPYD AltSymbols EntrezGene 1806 OMIM 274270 RefSeq NM 000110 UniProt PDB ECnumber 1.3.1.2 Chromosome 1 Arm p Band 22 LocusSupplementaryData Dihydropyrimidine dehydrogenase DPD is an enzyme that is involved in pyrimidine degradation. It is the initial and rate limiting step in pyrimidine catabolism. It catalyzes the reduction of uracil and thymine . It is also involved in the degradation of the chemotherapeutic drugs 5 fluorouracil and Tegafur uracil . See also Dihydropyrimidine dehydrogenase deficiency External links enzyme stub Nucleotide metabolism de Dihydropyrimidin Dehydrogenase ... more details
chembox verifiedrevid 384092886 ImageFile Dihydrothymine.png ImageSize 150px IUPACName 5 methylhexahydropyrimidine 2,4 dione OtherNames Section1 Chembox Identifiers CASNo 696 04 8 PubChem 93556 SMILES CC1CNC O NC1 O MeSHName 5,6 dihydrothymine Section2 Chembox Properties Formula C sub 5 sub H sub 8 sub N sub 2 sub O sub 2 sub MolarMass 128.12922 Appearance Density MeltingPt BoilingPt Solubility Section3 Chembox Hazards MainHazards FlashPt Autoignition Dihydrothymine is an intermediate in the metabolism of thymine . Nucleotide metabolism intermediates Category Ureas Category imides Category Pyrimidinediones organic compound stub ja ... more details
out the majority of chemical reaction s that occur inside the cell biology cell . T span id thymine span Thymine One of the four nucleotide nucleotide bases in DNA DNA pairs with adenine adenine . In RNA RNA , thymine is replaced with uracil uracil . span id transcription span Transcription genetics ... DNA , uracil is replaced with thyminethymine . DEFAULTSORT Genetics Glossary Category Genetics ... more details
has uridine uracil joined to ribose instead. Uracil is chemically very similar to thymine, the latter being 5 methyluracil. Since thymine nucleotides are precursors of DNA, not RNA, the prefix deoxy is often ... more details
Image DNA UV mutation.svg thumb right 300px DNA Lesion Thymine Dimer Pyrimidine dimers are molecular lesion s formed from thymine or cytosine bases in DNA via photochemical reaction s. ref cite journal title The Molecular Perspective Ultraviolet Light and Pyrimidine Dimers author David S. Goodsell journal The Oncologist volume 6 issue 3 pages 298 299 year 2001 url http theoncologist.alphamedpress.org cgi content full 6 3 298 doi 10.1634 theoncologist.6 3 298 pmid 11423677 ref ref cite book title DNA repair and mutagenesis author E. C. Friedberg, G. C. Walker, W. Siede, R. D. Wood, R. A. Schultz and T. Ellenberger publisher ASM Press place Washington issue year 2006 url isbn 978 1555813192 page 1118 ref Ultraviolet light induces the formation of covalent bond covalent linkages by reactions localized on the C C double bonds. ref cite journal title Effect of photoreactivating light on UV radiation induced alterations in human skin author S. E. Whitmore, C. S. Potten, C. A. Chadwick, P. T. Strickland, W. L. Morison journal Photodermatol. Photoimmunol. Photomed. volume 17 issue 5 pages 213 217 year 2001 pmid 11555330 doi 10.1034 j.1600 0781.2001.170502.x ref In dsRNA , uracil dimers may also accumulate as a result of UV radiation. Two common UV products are cyclobutane pyrimidine dimers CPDs, including thymine dimers and 6,4 photoproducts. These premutagenic lesions alter the structure of DNA and consequently inhibit polymerases and arrest replication. Dimers may be repaired by photoreactivation or nucleotide excision repair, but unrepaired dimers are mutagenic. Pyrimidine dimers ... Image Photodimer.png thumb 350px alt Photodimers Photodimers derived from thymine. Left Spore photoproduct ... oclc doi accessdate ref Spore photoproduct lyase provides another enzymatic pathway for repair of thymine ... and in eukaryotes. Although the thyminethymine CPDs thymine dimers are the most frequent lesions ... duplex d GCGTTGCG d GCGAAGCG induced by formation of a cis syn thymine dimer url journal European ... more details
, and thymine is pyrimidine , hence pyrimidine bases . Primary bases These are incorporated into the growing ... of guanine br Guanine Image Thymine chemical structure.png 63px Chemical structure of thymine br Thymine ... more details
Unreferenced auto yes date December 2009 Suicide inhibition , also known as suicide inactivation or mechanism based inhibition , is a form of irreversible enzyme inhibition that occurs when an enzyme binds a substrate analogue and forms an irreversible complex with it through a covalent bond during the normal catalysis reaction . The inhibitor binds to the active site where it is modified by the enzyme to produce a reactive group that reacts irreversibly to form a stable inhibitor enzyme complex. This usually uses a prosthetic group or a coenzyme , forming electrophilic alpha and beta unsaturated carbonyl compounds and imines. Examples Some clinical examples of suicide inhibitors include Penicillin , which inhibits DD transpeptidase from building bacterial cell wall s. Sulbactam , which prohibits penicillin resistant strains of bacteria from metabolizing penicillin. Allopurinol , which inhibits uric acid production by xanthine oxidase in the treatment of gout . Zidovudine AZT zidovudine and other chain terminating nucleoside analogues used to inhibit HIV 1 reverse transcriptase in the treatment of HIV AIDS . Eflornithine , one of the drugs used to treat African trypanosomiasis sleeping sickness is a suicide inhibitor of ornithine decarboxylase . 5 fluorouracil acts as a suicide inhibitor of thymidylate synthase during the synthesis of thymine from uridine. This reaction is crucial for the proliferation of cells, particularly those that are rapidly proliferating such as fast growing cancer tumors . By inhibiting this step, cells die from a Thymineless Death thymineless death because they have no thymine to create more DNA. This is often used in combination with Methotrexate , a potent inhibitor of dihydrofolate reductase enzyme. Exemestane , a drug used in the treatment of breast cancer, is an inhibitor of the aromatase enzyme. Rational drug design Suicide inhibitors are used in what is called rational drug design where the aim is to create a novel substrate, based o ... more details
For complementation and complementation tests used in genetics research Complementation genetics Other uses Complement disambiguation Unreferenced date December 2009 File Complementarity DNA .png thumb right 250px On the left nucleotide s that form the DNA and their complementary. Between A and T there are two hydrogen bonds, while 3 are between C and G. On the right a DNA sequence and its complementary strand. In molecular biology , complementarity is a property of double stranded nucleic acid s such as DNA , as well as DNA RNA duplexes. Each strand is complementary to the other in that the base pair s between them are non covalent bond covalently connected via two or three hydrogen bond s. For DNA, adenine A bases complement thymine T bases and vice versa guanine G bases complement cytosine C bases and vice versa . With RNA, it is the same except that adenine A bases complement uracil U bases instead of thymine T bases. Since there is only one complementary base for each of the bases found in DNA and in RNA, one can reconstruct a complementary strand for any single strand. All C bases in one strand will pair with G bases in the complementary strand, etc. This is essential for DNA replication . For example, the complementary strand of the DNA sequence tt 5 A G T C A T G 3 tt is tt 3 T C A G T A C 5 tt Note that the latter is often written as the reverse complement with the 5 end on the left and the 3 end on the right tt 5 C A T G A C T 3 tt A sequence that is equal to its reverse complement is said to be a palindromic sequence . See also Base pair External links http www.bioinformatics.org sms rev comp.html Reverse complement tool http www.dna.utah.edu utensils RCC.php Reverse Complement App DNA.UTAH.EDU DEFAULTSORT Complementarity Molecular Biology Category Molecular biology it Complementarit ru simple Complementarity molecular biology tr Tamamlay c l k molek ler biyoloji uk ur vi Nguy n t c b s ... more details
Excision repair is a term applied to several DNA repair mechanisms. They remove the damaged nucleotide s and are able to determine the correct sequence from the complementary strand of DNA. Specific mechanisms include Base excision repair BER , which repairs damage due to a single nucleotide caused by redox oxidation , alkylation , hydrolysis , or deamination Nucleotide excision repair NER , which repairs damage affecting 2&minus 30 nucleotide length strands. These include bulky, helix distorting damage, such as thymine Dimer chemistry dimerization and other types of cyclobutyl dimer ization caused by UV light as well as single strand breaks. A specialized form of NER known as Transcription Coupled Repair TCR deploys high priority NER repair enzyme s to gene s that are being actively transcription genetics transcribed Mismatch repair MMR , which corrects errors of DNA replication and genetic recombination recombination that result in mispaired nucleotides. biochemistry stub genetics stub DNA repair Category DNA repair ... more details
Orphan date February 2009 table class infobox bordered border 1 cellpadding 2 cellspacing 0 tr th colspan 2 align center bgcolor cccccc Bisbenzimide tr td Formula td td C sub 25 sub H sub 24 sub N sub 6 sub O tr td Molecular mass td td 533.88 amu td tr table Bisbenzimide is an organic compound used as a fluorescent stain for DNA in molecular biology applications. It is an intercalating agent between Adenine Thymine base pairs. Several bisbenzimides are used and are collectively called Hoechst stain s. Application Bisbenzimide tends to insert into A T rich regions of DNA and can decrease its density. Bisbenzimide mixed with DNA samples can then be used to separate DNA according to their AT percentage using a Cesium Chloride CsCl gradient centrifugation. References nofootnotes date December 2010 Sigma Aldrich Product Information Page Georg Hausner s molecular biology lecture notes unreliable source date December 2010 Category DNA binding substances ... more details
Unreferenced stub auto yes date December 2009 Excision endonuclease , also known as excinuclease or UV Specific Endonuclease , is a nuclease enzyme which excises a fragment of nucleotides during DNA repair . The excinuclease cuts out a fragment by hydrolyzing two phosphodiester bonds, one on either side of the lesion in the DNA. This process is part of nucleotide excision repair , a mechanism that can fix specific damages to the DNA in the G1 phase of the eukaryotic cell cycle . Such damages can include the thymine dimers created by UV rays. A deficiency of excinuclease occurs in a rare autosomal recessive disease called xeroderma pigmentosum . Diagnosis of this disease is done by measuring the enzyme s level in white blood cells in a blood sample. Symptoms in children include extreme ultraviolet UV sensitivity, excessive freckle freckling , multiple skin cancer s and corneal ulcer ations. Typically, these symptoms are seen during a child s first sun exposure. Citation needed date November 2009 Category DNA repair Enzyme stub ca escinucleasa es escinucleasa ... more details
Encyclopedia
top
