Search: in
cytosine
cytosine in Encyclopedia Encyclopedia
  Tutorials     Encyclopedia     Videos     Books     Software     DVDs  
       
Encyclopedia results for cytosine

cytosine





Encyclopedia results for cytosine

  1. Cytosine

    distinguish cytisine cysteine chembox verifiedrevid 443557332 ImageFile1 Cytosine chemical structure.png ImageSize1 120px ImageFile2 Cytosine 3D balls.png ImageSize2 180px ImageFile3 Cytosine 3D vdW.png ... UHFFFAOYAY MeSHName Cytosine Section2 Chembox Properties Formula C sub 4 sub H sub 5 sub ... Chembox Hazards MainHazards FlashPt Autoignition Cytosine C is one of the four main bases found in DNA ... keto group at position 2 . The nucleoside of cytosine is cytidine . In Watson Crick base pair ing, it forms three hydrogen bonds with guanine . History Cytosine was discovered by Albrecht Kossel ... in the same year. Cytosine recently found use in quantum computation . The first time ... on a two qubit NMRQC Nuclear Magnetic Resonance Quantum Computer based on the cytosine molecule ... ph 2F9801027 doi 10.1063 1.476739 id accessdate 2007 10 18 ref Chemical reactions File Cytosine chemical structure.svg thumb left 100px Cytosine with numbered components. Methylation occurs on carbon nr 5. Cytosine can be found as part of DNA, as part of RNA, or as a part of a nucleotide . As cytidine ... adenosine diphosphate ADP to adenosine triphosphate ATP . In DNA and RNA, cytosine is paired with guanine ... glycosylase, which cleaves a uracil in DNA. Cytosine can also be methylated into 5 methylcytosine by an enzyme ... . Active enzymatic deamination of cytosine or 5 methylcytosine by the APOBEC family of cytosine ... S. title Crosstalk between genetic and epigenetic information through cytosine deamination journal ... R title Prebiotic cytosine synthesis a critical analysis and implications for the origin of life ... fa fr Cytosine gl Citosina ko hi hr Citozin id Sitosina it Citosina he jv Sitosin kk lt Citozinas hu Citozin nl Cytosine ja no Cytosin oc Citosina pl Cytozyna pt Citosina ru simple Cytosine sk Cytoz n sl Citozin sr sh Citozin fi Sytosiini sv Cytosin tr Sitozin uk ur Cytosine vi Cytosine zh ...   more details



  1. Cytosine deaminase

    enzyme Name cytosine deaminase EC number 3.5.4.1 CAS number 9025 05 2 IUBMB EC number 3 5 4 1 GO code 0004131 image width caption In enzymology , a cytosine deaminase EC number 3.5.4.1 is an enzyme that catalysis catalyzes the chemical reaction cytosine H sub 2 sub O math rightleftharpoons math uracil NH sub 3 sub Thus, the two substrate biochemistry substrates of this enzyme are cytosine and water H sub 2 sub O , whereas its two product chemistry products are uracil and ammonia NH sub 3 sub . This enzyme belongs to the family of hydrolase s, those acting on carbon nitrogen bonds other than peptide bonds, specifically in cyclic amidines. The systematic name of this enzyme class is cytosine aminohydrolase . This enzyme is also called isocytosine deaminase . This enzyme participates in pyrimidine metabolism . Structural studies As of late 2007, 13 tertiary structure structures have been solved for this class of enzymes, with Protein Data Bank PDB accession codes PDB link 1K6W , PDB link 1K70 , PDB link 1OX7 , PDB link 1P6O , PDB link 1R9X , PDB link 1R9Y , PDB link 1RA0 , PDB link 1RA5 , PDB link 1RAK , PDB link 1RB7 , PDB link 1UAQ , PDB link 1YSB , and PDB link 1YSD . References reflist 1 cite journal author COHEN SS, BARNER HD date 1957 title The conversion of 5 methyldeoxycytidine to thymidine in vitro and in vivo journal J. Biol. Chem. volume 226 pages 631&ndash 42 pmid 13438848 issue 2 cite journal author Kream J and Chargaff E date 1952 title On the cytosine deaminase of yeast journal J. Am. Chem. Soc. volume 74 issue 20 pages 5157&ndash 5160 doi 10.1021 ja01140a050 hydrolase stub Category EC 3.5.4 Category Enzymes of known structure ...   more details



  1. Deamination

    lesion by replacement with another cytosine. A DNA Polymerase may perform this replacement ... the resulting nicked duplex product, which now includes a new, correct cytosine. See Base excision ... fork, which would fix the cytosine to thymine point mutation in one of the two daughter strands. Guanine ... to the enol tautomer of guanine, selectively base pairs with thymine instead of cytosine . This results ..., in a manner analogous to the imine tautomer of adenine, selectively base pairs with cytosine instead ...   more details



  1. List of Y-DNA single-nucleotide polymorphisms

    tgtatctttagttgagatgg M368 Adenine A to Cytosine C 200 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M369 Guanine G to Cytosine C 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg M370 Cytosine C ...   more details



  1. C4H5N3O

    DISPLAYTITLE C sub 4 sub H sub 5 sub N sub 3 sub O The molecular formula C sub 4 sub H sub 5 sub N sub 3 sub O may refer to Cytosine Isocytosine MolFormDisambig sr C4H5N3O ...   more details



  1. Nitrogenous base

    Refimprove auto yes date December 2009 Image Cytosine chemical structure.png Cytosine 100px right Cytosine Image Thymine chemical structure.png Thymine 100px right Thymine Image Uracil chemical structure.png Uracil 100px right Uracil Image Adenine chemical strucfture.png Adenine 100px right Adenine Image Guanine chemical structure.png Guanine 100px right Guanine A nitrogenous nitrogen containing base is a nitrogen containing molecule having the chemical properties of a base. It is an organic compound that owes its property as a Base chemistry base to the lone pair of electron s of a nitrogen atom . In biological science s, nitrogenous bases are typically classified as the derivatives of two parent compounds, pyrimidine and purine . ref Nelson and Cox 2008, p. 272. ref They are non polar and due to their aromaticity , planar. Both pyrimidines and purines resemble pyridine and are thus weak bases and relatively unreactive towards electrophilic aromatic substitution . ref Carey 2006, p. 1206. ref Their flat shape is particularly important when considering their roles in nucleic acids as nucleobase s building blocks of DNA and RNA adenine , guanine , thymine , cytosine , and uracil . These nitrogenous bases hydrogen bond between opposing DNA strands to form the rungs of the twisted ladder or double helix of DNA or a biological catalyst that is found in the nucleotides. Adenine is always paired with thymine, and guanine is always paired with cytosine. Uracil is only present in RNA replacing thymine and pairing with adenine. Notes Reflist References Nelson, David L. and Michael M. Cox 2008 . Principles of Biochemstry , ed. 5, W.H. Freeman and Company. Carey, Francis A. 2008 . Organic Chemistry , ed. 6, Mc Graw Hill. DEFAULTSORT Nitrogenous Base Category Biochemistry Biochemistry stub ar ca Base nitrogenada es Base nitrogenada eo Nitrogena bazo gl Base nitroxenada lt Nukleobaz pt Base nitrogenada th tr Azotlu baz zh ...   more details



  1. CpG site

    Image Cytosine chemical structure.png thumb right upright Cytosine Image Phosphate formula.svg thumb right Phosphate Image Guanine chemical structure.png thumb Guanine CpG sites or CG sites are regions of DNA where a cytosine nucleotide occurs next to a guanine nucleotide in the linear DNA sequence sequence of Base pair base s along its length. CpG is shorthand for C phosphate G , that is, cytosine and guanine separated by only one phosphate phosphate links any two nucleoside s together in DNA. The CpG notation is used to distinguish this linear sequence from the CG base pair base pairing of cytosine and guanine. Cytosines in CpG dinucleotides can be methylated to form 5 methylcytosine . In mammal s, methylating the cytosine within a gene can turn the gene off, a mechanism that is part of a larger field of science studying gene regulation that is called epigenetics . Enzymes that add a methyl group are called DNA methyltransferase s. In mammals, 70 to 80 of CpG cytosines are methylated. ref name Jabbari2004 cite journal author Jabbari K, Bernardi G title Cytosine methylation and CpG, TpG CpA and TpA frequencies journal Gene volume 333 issue pages 143 9 year 2004 month May pmid 15177689 doi 10.1016 j.gene.2004.02.043 url http linkinghub.elsevier.com retrieve pii S0378111904000836 ref Unmethylated CpG sites can be detected by Toll Like Receptor 9 ref http iai.asm.org cgi content abstract 76 5 2123?maxtoshow &hits 10&RESULTFORMAT &fulltext fumigatus&searchid 1&FIRSTINDEX 30&resourcetype HWFIG ref TLR 9 on plasmacytoid dendritic cell s and B cell s in humans. This is used to detect intracellular viral, fungal, and bacterial pathogen DNA. Frequency in vertebrates CpG dinucleotides have long been observed to occur with a much lower frequency in the sequence of vertebrate genomes ... content , a pair of nucleotides consisting of cytosine followed by guanine would be expected to occur ... cytosine methylation. ref cite journal author Scarano E, Iaccarino M, Grippo P, Parisi E title ...   more details



  1. 5-Methylcytosine

    methylated form of the DNA base cytosine that may be involved in the regulation of gene Transcription genetics transcription . When cytosine is methylated, the DNA maintains the same sequence ... . This methyl group distinguishes 5 methylcytosine from cytosine. In vivo 5 Methylcytosine is an Epigenetics epigenetic modification formed by the action of DNA methyltransferase s. File Cytosine 5 methylation.png ... are methylated in vertebrate s. While spontaneous deamination of cytosine forms uracil , which is recognized ... of a DNA base from cytosine C to thymine T can result in a Transition genetics transition mutation . In addition, active enzymatic deamination of cytosine or 5 methylcytosine by the APOBEC family of cytosine deaminases could have beneficial implications on various cellular processes as well ... cytosine deamination journal Trends in Genetics volume 26 pages 443 448 year 2010 doi 10.1016 j.tig.2010.07.005 ... from 5 Methylcytosine to form thymine with use of reagents such as nitrous acid cytosine deaminates ... treatment, which deaminates cytosine residues. This property is often exploited to analyze DNA cytosine methylation patterns with bisulfite sequencing . ref cite journal author Clark SJ, Harrison ...   more details



  1. Pyrimidone

    chembox verifiedrevid 385317369 Name 4 Pyrimidone ImageFile Pyrimidone.png ImageSize 120px IUPACName Pyrimidone OtherNames Hydroxypyrimidine Pyrimidinone Section1 Chembox Identifiers CASNo 51953 17 4 PubChem 20695 SMILES O C1NC NC C1 Section2 Chembox Properties C 4 H 4 N 2 O 1 Appearance White to light yellow powder Density MeltingPt 163 168 C BoilingPt Solubility Section3 Chembox Hazards MainHazards Respiratory system, eye, skin irritation FlashPt Autoignition Pyrimidone is the name given to either of two heterocyclic compound s with the formula Carbon C sub 4 sub Hydrogen H sub 4 sub Nitrogen N sub 2 sub Oxygen O 2 pyrimidone and 4 pyrimidone . The compounds can also be called 2 hydroxypyrimidine or 4 hydroxypyrimidine respectively, based on a Substitution reaction substituted pyrimidine , or 1,3 diazine , ring. Derivatives Derivatives of pyrimidone are the basis of many other biological molecules, including Nucleobases , such as cytosine Barbiturates , such as metharbital gallery File Cytosine chemical structure.png Cytosine File Metharbital.png Metharbital gallery See also Pyrimidine Category Pyrimidones Heterocyclic stub fa zh ...   more details



  1. Methylation induced premeiotically

    Orphan date April 2012 One source article date August 2011 In molecular biology , methylation induced premeiotically MIP is a process by which cytosine s within repeated DNA sequences are de novo methylated prior to the sexual cycle. This process was first described in the ascomycete Ascobolus immersens . MIP is dependent upon the gene masc1 which encodes a cytosine methyltransferase like protein. ref name pmid9346245 cite journal pages 281 90 doi 10.1016 S0092 8674 00 80410 9 title A Gene Essential for De Novo Methylation and Development in Ascobolus Reveals a Novel Type of Eukaryotic DNA Methyltransferase Structure year 1997 last1 Malagnac first1 F journal Cell volume 91 issue 2 pmid 9346245 last2 Wendel first2 B last3 Goyon first3 C last4 Faugeron first4 G last5 Zickler first5 D last6 Rossignol first6 JL last7 Noyer Weidner first7 M last8 Vollmayr first8 P last9 Trautner first9 TA ref At least one major function of the process appears to be genome defense. Related functions have been found in other fungi, including Neurospora and Aspergillis species. ref Lee DW, Freitag M, Selker EU, Aramayo R 2008 A Cytosine Methyltransferase Homologue Is Essential for Sexual Development in Aspergillus nidulans. PLoS ONE 3 6 e2531. doi 10.1371 journal.pone.0002531 ref References reflist Category Molecular biology molecular cell biology stub ...   more details



  1. High-GC content bacteria

    High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria   ref NCBI Taxonomy browser, http www.ncbi.nlm.nih.gov Taxonomy Browser wwwtax.cgi?mode Undef&id 201174&lvl 3&lin f&keep 1&srchmode 1&unlock, accessed 3 13 07. ref . For more information, see GC content . References references bacteria stub Category Microbiology ...   more details



  1. Pyrimidine analogue

    Pyrimidine analogues are antimetabolite s which mimic the structure of metabolic pyrimidine s. Examples Examples include Fluorouracil 5 fluorouracil 5FU which inhibits thymidylate synthase . Floxuridine FUDR Cytosine arabinoside Cytarabine 6 azauracil gallery Image Pyrimidin.svg Pyrimidine Image Fluorouracil.svg Fluorouracil Image Floxuridine.png Floxuridine Image Gemcitabine.svg Gemcitabine gallery Chemotherapeutic agents Antivirals Nucleobases, nucleosides, and nucleotides Category Metabolism Category Pyrimidines chemistry stub pa sr Analogni pirimidini ...   more details



  1. Antileukemic drug

    Unreferenced date October 2008 Antileukemic drugs , Chemotherapy anticancer drugs that are used to treat one or more types of leukemia , include Mercaptopurine 6 Mercaptopurine 6 Thioguanine Aminopterin Arsenic trioxide Asparaginase Cladribine Clofarabine Cyclophosphamide Cytosine arabinoside Dasatinib Daunorubicin Decitabine Dexamethasone Etoposide Fludarabine Gemtuzumab ozogamicin Idarubicin Imatinib mesylate Interferon Interleukin 2 Melphalan Methotrexate Mitoxantrone Nelarabine Nilotinib Oblimersen Pegaspargase Pentostatin Prednisone Rituximab Tretinoin Vincristine Category Leukemia antineoplastic drug stub ...   more details



  1. B recognition element

    The B recognition element BRE is a DNA sequence found in the promoter region of most genes in eukaryote s and Archaea . ref name Lagrange cite journal author Lagrange T, Kapanidis AN, Tang H, Reinberg D, Ebright RH year 1998 journal Genes and Development volume 12 issue 1 pages 34 44 title New core promoter element in RNA polymerase II dependent transcription sequence specific DNA binding by transcription factor IIB pmid 9420329 doi 10.1101 gad.12.1.34 pmc 316406 ref ref cite journal journal Proceedings of the National Academy of Sciences of the USA title The structural basis for the oriented assembly of a TBP TFB promoter complex year 1999 author Littlefield O, Korkhin Y, Sigler PB volume 96 issue 24 pages 13668 13673 pmid 10570130 doi 10.1073 pnas.96.24.13668 pmc 24122 ref The BRE is a cis regulatory element that is found immediately upstream of the TATA box , and consists of 7 nucleotide s. The BRE was discovered in 1998 by Richard H. Ebright Richard Ebright and co workers ref name Lagrange Overview The first two nucleotides of the BRE sequence can be either guanine or cytosine . The third nucleotide is either guanine or adenine . The next four nucleotides are always the same cytosine, guanine, cytosine, cytosine. G C G C G A C G C C. The Transcription Factor IIB TFIIB recognizes this sequence in the DNA, and binds to it. The fourth and fifth alpha helix alpha helices of TFIIB intercalate with the DNA Grooves major groove of the DNA at the BRE. TFIIB is one part of the Transcription preinitiation complex preinitiation complex that helps RNA Polymerase II bind to the DNA. See also Promoter biology CAAT box Enhancer genetics Insulator genetics Initiator element Transcription start site References reflist Transcription Category Regulatory sequences genetics stub ...   more details



  1. Acytosiosis

    Orphan date February 2009 Acytosiosis is a rare genetic disorder . Causes Acytosiosis is caused by an autosomal recessive mutation on Chromosome 9 , which causes a defect in the enzyme Alpha cytosinase . ref Wynbrandt, James and Ludman, Mark The Encyclopedia of Genetic Disorders and Birth Defects Facts on File 2000 Special BookSources 9780816038091 ISBN 978 0 8160 3809 1 ref Symptoms Because of the complete lack of cytosine due to the defective Alpha cytosinase, DNA replication cannot occur. This means that any zygote with Acytosiosis will be unable to divide into multiple cells and will thus die. In most cases, the mother won t even know that she would have had a baby if it hadn t died from Acytosiosis. ref Narins, Brigham The Gale Encyclopedia of Genetic Disorders Gale Group 2005 Special BookSources 9781414403663 ISBN 978 1 4144 0366 3 ref Etymology The name Acytosiosis comes from a combination of the prefix a , meaning no or none , cytosine , and the suffix iosis , meaning disorder . References reflist Category Genetic disorders with no OMIM ...   more details



  1. TRNA (cytosine-5-)-methyltransferase

    enzyme Name tRNA cytosine 5 methyltransferase EC number 2.1.1.29 CAS number 37256 97 6 IUBMB EC number 2 1 1 29 GO code 0016428 image width caption lowercase In enzymology , a tRNA cytosine 5 methyltransferase EC number 2.1.1.29 is an enzyme that catalysis catalyzes the chemical reaction S adenosyl L methionine tRNA math rightleftharpoons math S adenosyl L homocysteine tRNA containing 5 methylcytosine Thus, the two substrate biochemistry substrates of this enzyme are S Adenosyl methionine S adenosyl methionine and tRNA , whereas its two product chemistry products are S adenosylhomocysteine and tRNA containing 5 methyl cytosine . This enzyme belongs to the family of transferase s, specifically those transferring one carbon group methyltransferases. The systematic name of this enzyme class is S adenosyl L methionine tRNA cytosine 5 methyltransferase . Other names in common use include transfer ribonucleate cytosine 5 methyltransferase , and transfer RNA cytosine 5 methyltransferase . References reflist 1 cite journal author Hurwitz J, Gold M, Anders M date 1964 title The Enzymatic Methylation of Ribonucleic Acid and Deoxyribonucleic Acid. 3. Purification of Soluble Ribonucleic Acid Methylating Enzymes journal J. Biol. Chem. volume 239 pages 3462&ndash 3473 pmid 14245404 cite journal author Bjork GR, Svensson I date 1969 title Studies on microbial RNA. Fractionation of tRNA methylases from Saccharomyces cerevisiae journal Eur. J. Biochem. volume 9 pages 207&ndash 215 pmid 69267419 doi 10.1111 j.1432 1033.1969.tb00596.x issue 2 cite journal author Keith JM, Winters EM, Moss B date 1980 title Purification and characterization of a HeLa cell transfer RNA cytosine 5 methyltransferase journal J. Biol. Chem. volume 255 pages 4636&ndash 4644 pmid 7372600 issue 10 transferase stub Category EC 2.1.1 Category Enzymes of unknown structure it TRNA citosina 5 metiltransferasi ...   more details



  1. RNA-Directed DNA Methylation

    Technical date May 2010 RNA directed DNA methylation RdDM is an epigenetics epigenetic process first elucidated in plants whereby small double stranded RNA s dsRNA s are processed to guide methylation to complementary DNA locus genetics loci . In the model plant organism Arabidopsis thaliana , these small dsRNA s may be generated from three sources Viral replication intermediates Products of the endogenous RNA dependent RNA polymerase Transcribed inverted repeats These dsRNAs are then processed to direct histone 3 lysine 9 H3K9 methylation via Ago4 and the SUVH Suppressor of Variegation Homolog histone methyltransferase family. This H3K9 dimethylation is then putatively bound by the cytosine methyltransferase CMT3, which methylates cytosines in a non CG context. These marks, H3K9 dimethylation and cytosine methylation, are canonical marks of gene silencing . Thus small double stranded RNAs generated in diverse contexts bring about transcriptional silencing at specific loci. References http www.pnas.org content 99 suppl.4 16499.full.pdf PNAS 2004 Review Article http jcs.biologists.org cgi content abstract 117 21 4881 JCS 2004 Review Article http www.springerlink.com content n148797wh3124068 Hypothesis of initiation of DNA methylation de novo and allelic exclusion by small RNAs Categories DEFAULTSORT Rna Directed Dna Methylation Category Genetics ...   more details



  1. NGSmethDB

    Orphan date January 2011 infobox biodatabase title NGSmethDB logo File Database.png description next generation sequencing single cytosine resolution DNA methylation data. scope organism human br mouse br Arabidopsis center laboratory author pmid Michael Hackenberg & al. 2011 ref name pmid20965971 released 2010 standard format url http bioinfo2.ugr.es NGSmethDB gbrowse download webservice sql sparql webapp standalone license versioning frequency curation bookmark version NGSmethDB is a database of dna methylation methylation data derived from next generation sequencing data. ref name pmid20965971 cite journal quotes yes last Hackenberg first Michael authorlink coauthors Barturen Guillermo, Oliver Jos L year 2011 month Jan title NGSmethDB a database for next generation sequencing single cytosine resolution DNA methylation data journal Nucleic Acids Res. volume 39 issue Database issue pages D75 9 publisher location England issn pmid 20965971 doi 10.1093 nar gkq942 bibcode oclc id url pmc 3013793 language eng format accessdate laysummary laysource laydate quote ref References references See also DNA methylation MethDB External links http bioinfo2.ugr.es NGSmethDB gbrowse Biodatabase stub Category Biological databases Category Epigenetics Category DNA Category DNA sequencing ...   more details



  1. Ribonucleotide

    A ribonucleotide or ribotide is a nucleotide in which a purine or pyrimidine base is linked to a ribose molecule and exactly one phosphate group. ref cite book title The ACS style guide effective communication of scientific information year 2006 publisher American Chemical Society location Washington, D.C. isbn 9780841239999 edition 3rd editor Coghill, Anne M. Garson, Lorrin R. page 244 ref In living organisms the most common bases for ribonucleotides are adenine A , guanine G , cytosine C , or uracil U . See also Ribonucleosides or ribosides References reflist Nucleobases, nucleosides, and nucleotides Category RNA Category Ribosides Biochem stub bg de Ribonukleotide es Ribonucle tido fr Ribonucl otide it Ribonucleotide nl Ribonucleotide oc Ribonucleotid pl Rybonukleotydy ru sr Ribonukleotid ...   more details



  1. Nucleoside triphosphate

    unreferenced date February 2007 Nucleoside triphosphate NTP is a molecule containing a nucleoside bound to three phosphate s. Natural nucleoside triphosphates include adenosine triphosphate ATP , guanosine triphosphate GTP , cytidine triphosphate CTP , 5 methyluridine triphosphate m sup 5 sup UTP , and uridine triphosphate UTP . These terms refer to those nucleoside triphosphates that contain ribose. The nucleoside triphosphates containing deoxyribose take prefix deoxy in their names and small d in their abbreviations deoxyadenosine triphosphate dATP , deoxyguanosine triphosphate dGTP , deoxycytidine triphosphate dCTP , deoxythymidine triphosphate dTTP and deoxyuridine triphosphate . Check the entry nucleoside for table and description of these compounds. Apart from d ATP, d GTP, d CTP, d TTP and d UTP, there are other less abundant NTPs, such as intermediates of nucleotide metabolism, but also rare natural nucleotides or even artificial nucleotides . The rare NTP are tautomeric forms of the NTPs. They cause mismatched base pairing during DNA replication. For example, a tautomeric form of cytosine is capable of forming 3 h bonds with adenine, and it will spontaneously revert to its original cytosine form, causing a mismatch. By a similar token, the deamination of cytosine leads to uracil, whereas a deamination of a commonly encountered in eukaryotes 5 methylcytosine will lead to thymine. However, the 5 to 3 DNA replication ensures that these mismatched bases are excised. Nucleotide derivatives are necessary for life, as they are building blocks of nucleic acid s and have thousands of other roles in cell metabolism and regulation. ATP is a major source of cellular energy. GTP is a very frequent cofactor of enzymes and proteins. NTPs generally provide energy and phosphate group for phosphorylations. Generally nucleoside s are nucleotide s sugar covalently bonded to a nitrogenous base, such as adenine, guanine, cytosine... that lack phosphates. However, for the sake of ...   more details



  1. HELP assay

    M, Khulan B, et al. title An analytical pipeline for genomic representations used for cytosine ...   more details



  1. ACGT

    ACGT stands for the four nucleic acid bases that make up DNA . The A stands for Adenine and pairs with the T , which stands for Thymine . The C stands for Cytosine and pairs with the G , Guanine . These four nucleic acids make up a creature s genetic code, or DNA. ref name intro cite web title Introduction to Genes and DNA publisher Health Grades url http www.wrongdiagnosis.com genetics dna.htm year 2004 accessdate 2010 03 03 archiveurl http web.archive.org web 20100208123830 http wrongdiagnosis.com genetics dna.htm archivedate 8 February 2010 DASHBot deadurl no ref ACGU stands for the four amino acids that make up RNA . RNA pairs up the same as DNA, except that Thymine is replaced with Uracil . ref name intro References reflist genetics stub Category Acids ...   more details



  1. Nucleobase cation symporter-1

    Pfam box Symbol Transp cyt pur Name Permease for cytosine purines, uracil, thiamine, allantoin image width caption Pfam PF02133 InterPro IPR001248 SMART Prosite SCOP TCDB 2.A.39 OPM family 67 OPM protein 2x79 PDB The Nucleobase Cation Symporter 1 NCS1 family consists of bacterial and yeast transporters for nucleobases including purines and pyrimidines . Members of this family possess twelve transmembrane a helical spanners TMSs . At least some of them have been shown to function in uptake by substrate H symport mechanism. See also InterPro IPR012681 and InterPro IPR012732 . Category Protein domains Category Protein families Category Membrane proteins membrane protein stub InterPro content IPR001248 ...   more details



  1. Nucleobase

    attached at the 5 carbon is called a nucleotide . Apart from adenine A , cytosine C , guanine G , thymine ... of cytosine results in uracil. In August 2011, a report, based on NASA studies with meteorites found ... of adenine and guanine is purine , hence the name purine bases . The skeleton of cytosine, uracil ... Image Cytosine chemical structure.png 51px Chemical structure of cytosine br Cytosine Image Uracil ...   more details



  1. Transition (genetics)

    Not to be confused with the evolutionary concept of a transitional fossil . Image Transitions transversions.png thumb right 300px Definition of transitions and transversions. In genetics, a transition is a point mutation that changes a purine nucleotide to another purine Adenine A Guanine G or a pyrimidine nucleotide to another pyrimidine Cytosine C Thymine T . Approximately two out of three single nucleotide polymorphism s SNPs are transitions. ref cite journal author Collins DW, Jukes TH title Rates of transition and transversion in coding sequences since the human rodent divergence journal Genomics volume 20 issue 3 pages 386 96 year 1994 month April pmid 8034311 doi 10.1006 geno.1994.1192 url http linkinghub.elsevier.com retrieve pii S0888 7543 84 71192 X ref Transitions can be caused by oxidative deamination and tautomerization . ref http www.mun.ca biochem courses 3107 Topics Mutations.html Mutations & Mutagenesis Bot generated title ref Although there are twice as many possible transversions , transitions appear more often in genomes, possibly due to the molecular mechanisms that generate them ref cite journal author Ebersberger I, Metzler D, Schwarz C, P bo S title Genomewide comparison of DNA sequences between humans and chimpanzees journal Am. J. Hum. Genet. volume 70 issue 6 pages 1490 7 year 2002 month June pmid 11992255 pmc 379137 doi 10.1086 340787 url http linkinghub.elsevier.com retrieve pii S0002 9297 07 60701 0 ref . 5 Methylcytosine is more prone to transition than unmethylated cytosine , due to spontaneous deamination . Fact taken from 5 Methylcytosine and deamination pages This mechanism is important because it dictates the rarity of CpG islands . See also Transversion References reflist External links http www.mun.ca biology scarr Transitions vs Transversions.html Diagram at mun.ca Cell biology stub Mutation Category Mutation bg de Transition Genetik es Transici n mutaci n ADN pl Tranzycja biologia pt Transi o ...   more details




Articles 1 - 25 of 366          Next


Search   in  
Search for cytosine in Tutorials
Search for cytosine in Encyclopedia
Search for cytosine in Videos
Search for cytosine in Books
Search for cytosine in Software
Search for cytosine in DVDs
Search for cytosine in Store


Advertisement




cytosine in Encyclopedia
cytosine top cytosine

Home - Add TutorGig to Your Site - Disclaimer

©2011-2013 TutorGig.info All Rights Reserved. Privacy Statement