Search: in
deoxyribose
deoxyribose in Encyclopedia Encyclopedia
  Tutorials     Encyclopedia     Videos     Books     Software     DVDs  
       
Encyclopedia results for deoxyribose

deoxyribose





Encyclopedia results for deoxyribose

  1. Pentose

    A pentose is a monosaccharide with five carbon atom s. ref http www.merriam webster.com dictionary pentose Pentose , Merriam Webster ref Pentoses are organized into two groups. Aldopentoses have an aldehyde functional group at position 1. Ketopentoses have a ketone functional group in position 2 or 3. Aldopentoses The aldopentoses have three chiral center s and therefore eight different stereoisomer s are possible. class wikitable align center File D arabinose.png 150px br br small D small Arabinose File D lyxose.png 150px br br small D small Lyxose File D Ribose.png 150px br br small D small Ribose File Xylose linear.png 150px br br small D small Xylose align center File arabinose.png 150px br br small L small Arabinose File lyxose.png 150px br br small L small Lyxose File L ribose.png 150px br br small L small Ribose File L xylose.png 150px br br small L small Xylose Ketopentoses The 2 ketopentoses have two chiral centers, and therefore four different stereoisomers are possible. The 3 ketopentoses are rare. class wikitable align center File Ribulose.png 150px br br small D small Ribulose File D xylulose.png 150px br br small D small Xylulose align center File L ribulose.png 150px br br small L small Ribulose File Xylulose.png 150px br br small L small Xylulose Properties The aldehyde and ketone functional groups in these carbohydrates react with neighbouring hydroxyl functional groups to form intramolecular hemiacetal s and hemiketal s, respectively. The resulting ring structure is related to furan , and is termed a furanose . The ring spontaneously opens and closes, allowing rotation to occur about the bond between the carbonyl group and the neighbouring carbon atom &mdash yielding two distinct configurations and . This process is termed mutarotation . Ribose is a constituent of RNA , and the related deoxyribose of DNA . A polymer composed of pentose sugars is called a pentosan . See also Diose Triose Tetrose Hexose Heptose Pentose phosphate pathway The anili ...   more details



  1. Xylulose

    chembox verifiedrevid 444246929 Reference ref Data is for L xylulose. ref ref Merck Index , 11th Edition, 9996 . ref ImageFileL1 L xylulose.png ImageSizeL1 ImageFileR1 xylulose.png ImageSizeR1 150px IUPACName 3R,4S 1,3,4,5 Tetrahydroxypentan 2 one OtherNames threo Pentulose br threo 2 Pentulose Section1 Chembox Identifiers ChemSpiderID Ref chemspidercite correct chemspider ChemSpiderID 20892 StdInChI Ref stdinchicite correct chemspider StdInChI 1S C5H10O5 c6 1 3 8 5 10 4 9 2 7 h3,5 8,10H,1 2H2 t3 ,5 m0 s1 StdInChIKey Ref stdinchicite correct chemspider StdInChIKey ZAQJHHRNXZUBTE WVZVXSGGSA N InChI 1S C5H10O5 c6 1 3 8 5 10 4 9 2 7 h3,5 8,10H,1 2H2 t3 ,5 m0 s1 InChIKey1 ZAQJHHRNXZUBTE WVZVXSGGSA N CASNo 5962 29 8 CASNo Ref cascite correct CAS CASNo Comment small D small small L small CASNo1 551 84 8 CASNo1 Ref cascite correct CAS CASNo1 Comment small D small CASNo2 527 50 4 CASNo2 Ref cascite correct CAS CASNo2 Comment small L small PubChem 22253 ChEBI Ref ebicite correct EBI ChEBI 17399 SMILES C C H C H C O CO O O O Section2 Chembox Properties Formula C sub 5 sub H sub 10 sub O sub 5 sub MolarMass 150.13 g mol Appearance Syrup Density MeltingPt BoilingPt Solubility Section3 Chembox Hazards MainHazards FlashPt Autoignition Xylulose is a ketopentose , a monosaccharide containing five carbon atom s, and including a ketone functional group . It has the chemical formula carbon sub 5 sub hydrogen sub 10 sub oxygen sub 5 sub . In nature, it occurs in both the small L small and small D small enantiomer s. Pathology small L small Xylulose accumulates in the urine in patients with pentosuria , due to a deficiency in L xylulose reductase . Since small L small xylulose is a reducing sugar like D glucose small D small glucose , pentosuria patients have been wrongly diagnosed in the past to be diabetic . See also Arabinose Deoxyribose Lyxose Ribose Ribulose Xylose References Reflist External links Carbohydrates ketone stub Category Ketopentoses bg ca Xilulosa de Xylulose ...   more details



  1. Thymidine monophosphate

    group group , the pentose sugar deoxyribose , and the nucleobase thymine . Unlike the other deoxyribonucleotide ...   more details



  1. Threose nucleic acid

    Threose nucleic acid TNA is a polymer similar to DNA or RNA but differing in the composition of its backbone . TNA is not known to occur naturally they are oligonucleotide synthesis synthesized chemically . DNA and RNA have a deoxyribose and ribose sugar backbone, respectively, whereas TNA s backbone is composed of repeating threose units linked by phosphodiester bond s. The threose molecule is easier to assemble than ribose making it a possible precursor to RNA. DNA TNA hybrid chains have been made in the laboratory using DNA polymerase. TNA can hybridize with RNA and DNA in a sequence specific manner this capability and chemical simplicity suggests that TNA could have preceded RNA as genetic material. See also Oligonucleotide synthesis Abiogenesis Glycol nucleic acid Peptide nucleic acid External links http www.newscientist.com article mg17924052.500 was simple tna the first nucleic acid on earth to carry a genetic code.html Was simple TNA the first nucleic acid on Earth to carry a genetic code? , New Scientist http www.sciencemag.org cgi content summary 290 5495 1306 ORIGIN OF LIFE A Simpler Nucleic Acid , Leslie Orgel References cite journal title A Simpler Nucleic Acid last Orgel first Leslie journal Science journal Science year 2000 month November pages 1306 1307 volume 290 issue 5495 doi 10.1126 science.290.5495.1306 pmid 11185405 cite journal title Modified nucleic acids on display last Watt first Gregory journal Nature Chemical Biology year 2005 month February url http www.nature.com nchembio journal vaop nprelaunch full nchembio005.html doi 10.1038 nchembio005 cite journal title Chemical etiology of nucleic acid structure the alpha threofuranosyl 3 2 oligonucleotide system. last Schoning first K coauthors Scholz P Guntha S Wu X Krishnamurthy R Eschenmoser A journal Science journal Science year 2000 month November pmid 11082060 doi 10.1126 science.290.5495.1347 volume 290 pages 1347 51 issue 5495 Nucleic acids Category Nucleic acids Category Polymers geneti ...   more details



  1. Glycol nucleic acid

    Glycol nucleic acid GNA is a polymer similar to DNA or RNA but differing in the composition of its backbone . GNA is not known to occur naturally they are oligonucleotide synthesis synthesized chemically . The 2,3 dihydroxypropylnucleoside analogues were first prepared by Ueda et al. 1971 . Soon thereafter it was shown that phosphate linked oligomers of the analogues do in fact exhibit hypochromicity in the presence of RNA and DNA in solution Seita et al. 1972 . The preparation of the polymers was later described by Cook et al. 1995, 1999 and Acevedo and Andrews 1996 . The GNA GNA self pairing described by Zhang and Meggers is however novel, and the specificity of interaction well demonstrated. DNA and RNA have a deoxyribose and ribose sugar backbone, respectively, whereas GNA s backbone is composed of repeating glycol units linked by phosphodiester bond s. The glycol unit has just three carbon atoms and still shows Watson Crick base pairing. Interestingly, the Watson Crick base pairing is much more stable in GNA than its natural counterparts DNA and RNA as it requires a high temperature to melt a duplex of GNA. It is possibly the simplest of the nucleic acids, so making it a hypothetical precursor to RNA. See also Oligonucleotide synthesis Abiogenesis Threose nucleic acid Peptide nucleic acid Locked nucleic acid References cite journal author Zhang Lilu, Peritz Adam, Meggers Eric title A simple glycol nucleic acid journal J Am Chem Soc volume 127 issue 12 pages 4174 5 year 2005 url http pubs.acs.org doi pdf 10.1021 ja042564z?cookieSet 1 pmid 15783191 doi 10.1021 ja042564z Seita, Tooru Yamauchi, Kiyoshi Kinoshita, Masayoshi Imoto, Minoru. Condensation polymerization of nucleotide analogues. Die Makromolekulare Chemie 1972 , 154 255 261. Ueda, Nasuo Kawabata, Toshio Takemoto, Kiichi. Synthesis of N 2,3 dihydroxypropyl derivatives of nucleic bases. Journal of Heterocyclic Chemistry 1971 , 8 5 , 827 9. Acevedo, Oscar L. Andrews, Robert S. Synthesis of propane 2,3 diol ...   more details



  1. Phosphopentomutase

    enzyme Name phosphopentomutase EC number 5.4.2.7 CAS number 9026 77 1 IUBMB EC number 5 4 2 7 GO code 0008973 image width caption In enzymology , a phosphopentomutase EC number 5.4.2.7 is an enzyme that catalysis catalyzes the chemical reaction alpha D ribose 1 phosphate math rightleftharpoons math D ribose 5 phosphate Hence, this enzyme has one substrate biochemistry substrate , alpha D ribose 1 phosphate , and one product chemistry product , D ribose 5 phosphate . This enzyme belongs to the family of isomerase s, specifically the phosphotransferases phosphomutases , which transfer phosphate groups within a molecule. The systematic name of this enzyme class is alpha D ribose 1,5 phosphomutase . Other names in common use include phosphodeoxyribomutase , deoxyribose phosphomutase , deoxyribomutase , phosphoribomutase , alpha D glucose 1,6 bisphosphate deoxy D ribose 1 phosphate , phosphotransferase , and D ribose 1,5 phosphomutase . This enzyme participates in pentose phosphate pathway and purine metabolism . It has 3 cofactor biochemistry cofactors D ribose 1,5 bisphosphate , alpha D Glucose 1,6 bisphosphate , and 2 Deoxy D ribose 1,5 bisphosphate . Structural studies The first published description of a tertiary structure structure of a prokaryotic phosphopentomutase was in 2011 ref Panosian, T. D., Nanneman, D. P., Watkins, G, Phalen V. V., McDonald W.H., Wadzinski B. E., Bachmann B. O., Iverson T.M. 2011. Bacillus cereus phosphopentomtuase is an alkaline phosphatase family member with an altered entry point into the catalytic cycle. J. Biol. Chem. 286 8043 8054 . cite journal pmid 21193409 doi 10.1074 jbc.M110.201350 volume 286 issue 10 title Bacillus cereus phosphopentomutase is an alkaline phosphatase family member that exhibits an altered entry point into the catalytic cycle year 2011 month March pages 8043 54 ref . Structures of Bacillus cereus phosphopentomutase as it was purified, after activation, bound to ribose 5 phosphate and bound to glucose 1,6 bispho ...   more details



  1. Nucleoside deoxyribosyltransferase

    enzyme Name nucleoside deoxyribosyltransferase EC number 2.4.2.6 CAS number 9026 86 2 IUBMB EC number 2 4 2 6 GO code 0050144 image width caption In enzymology , a nucleoside deoxyribosyltransferase EC number 2.4.2.6 is an enzyme that catalysis catalyzes the chemical reaction 2 deoxy D ribosyl base sub 1 sub base sub 2 sub math rightleftharpoons math 2 deoxy D ribosyl base sub 2 sub base sub 1 sub Thus, the two substrate biochemistry substrates of this enzyme are 2 deoxy D ribosyl base sub 1 sub and base sub 2 sub , whereas its two product chemistry products are 2 deoxy D ribosyl base sub 2 sub and base sub 1 sub . This enzyme belongs to the family of glycosyltransferase s, specifically the pentosyltransferases. The systematic name of this enzyme class is nucleoside purine pyrimidine deoxy D ribosyltransferase . Other names in common use include purine pyrimidine nucleoside purine pyrimidine deoxyribosyl , transferase , deoxyribose transferase , nucleoside trans N deoxyribosylase , trans deoxyribosylase , trans N deoxyribosylase , trans N glycosidase , nucleoside deoxyribosyltransferase I purine nucleoside purine , deoxyribosyltransferase strictly specific for transfer between , purine bases , nucleoside deoxyribosyltransferase II purine pyrimidine , and nucleoside purine pyrimidine deoxyribosyltransferase . This enzyme participates in pyrimidine metabolism . Structural studies As of late 2007, 12 tertiary structure structures have been solved for this class of enzymes, with Protein Data Bank PDB accession codes PDB link 1F8X , PDB link 1F8Y , PDB link 1S2D , PDB link 1S2G , PDB link 1S2I , PDB link 1S2L , PDB link 1S3F , PDB link 2A0K , PDB link 2F2T , PDB link 2F62 , PDB link 2F64 , and PDB link 2F67 . References reflist 1 cite journal author KALCKAR HM, MACNUTT WS, HOFF JORGENSEN E date 1952 title Trans N glycosidase studied with radioactive adenine journal Biochem. J. volume 50 pages 397&ndash 400 pmid 14915963 issue 3 pmc 1197666 cite journal author MACNUTT WS ...   more details



  1. Replisome

    With the primer, the sugar phosphate backbone is made of ribose and deoxyribose. code code indicates ... a duplex containing only deoxyribose which has a non reactive 2 H . DNA polymerase I DNA polymerase ... phosphate backbone. code code Original lagging strand deoxyribose phosphate backbone code ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG ..., and guanine. code code After DNA repair factor activity, the backbone is pure deoxyribose phosphate ... strand deoxyribose phosphate backbone code ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG code Original ... bases code code Newly synthesized deoxyribose phosphate backbone without Okazaki fragments. History ...   more details



  1. Photo 51

    Double helix2 Name big Photo 51 big Photo Photo 51.jpg Caption span style color ffffff Photo 51 , an X ray diffraction image of sodium salt of DNA. span Dna structure Alternative double helical structures B configuration Photo 51 is the nickname given to an X ray diffraction image of DNA taken by Rosalind Franklin in 1952 ref name Nova http www.pbs.org wgbh nova photo51 Secret of Photo 51 . Nova ref ref http books.google.com books?id Xwqxrh87EHcC&pg PA85&dq PHOTO 51 rosalind franklin&hl en&ei EbTTTeaQLcTGswb1paHkAg&sa X&oi book result&ct result&resnum 3&ved 0CEgQ6AEwAg v onepage&q PHOTO 2051 20rosalind 20franklin&f false The gene a historical perspective p.85. Greenwood Publishing Group, 2007 ref that was critical evidence ref name Novaflash http www.pbs.org wgbh nova photo51 anat flash.html Nova ref in identifying the structure of DNA. ref name Nature James D. Watson Watson JD , Francis Crick Crick FHC 1953 . A Structure for Deoxyribose Nucleic Acid . Nature 171 737 738. http www.nature.com nature dna50 watsoncrick.pdf Full text PDF ref The photo was taken by Franklin while working at King s College London in John Randall physicist Sir John Randall s group. James D. Watson was shown the photo by Maurice Wilkins , who had been given it by Raymond Gosling along with Francis Crick , he used Photo 51 to develop the first chemical model of DNA, for which the three men jointly won the 1962 Nobel Prize in Physiology or Medicine . As the Nobel prize is not awarded posthumously, Franklin, who had died in 1958, was not eligible for nomination. ref http news.bbc.co.uk 1 hi sci tech 2895681.stm My aunt, the DNA pioneer BBC News . Retrieved May 18, 2011 ref The photograph provided key information that was essential for developing a model of B form hydrated DNA. ref name Maddox, Brenda 2002 Maddox, Brenda 2002 . Rosalind Franklin The Dark Lady of DNA. HarperCollins. ISBN 0 06 018407 8. ref ref Watson JD, Crick FHC 1953 . A Structure for Deoxyribose Nucleic Acid . Nature 171 737 ...   more details



  1. Cytidine

    chembox verifiedrevid 443554948 ImageFile Cytidin.svg ImageSize 150px IUPACName 4 & x200b amino & x200b 1 & x200b 3,& x200b 4 & x200b dihydroxy & x200b 5 & x200b hydroxymethyl & x200b tetrahydrofuran & x200b 2 & x200b yl & x200b pyrimidin & x200b 2 & x200b one OtherNames Section1 Chembox Identifiers ChemSpiderID Ref chemspidercite correct chemspider ChemSpiderID 5940 KEGG Ref keggcite correct kegg KEGG D07769 InChI 1 C9H13N3O5 c10 5 1 2 12 9 16 11 5 8 7 15 6 14 4 3 13 17 8 h1 2,4,6 8,13 15H,3H2, H2,10,11,16 t4 ,6 ,7 ,8 m1 s1 InChIKey UHDGCWIWMRVCDJ XVFCMESIBD ChEMBL Ref ebicite correct EBI ChEMBL 95606 StdInChI Ref stdinchicite correct chemspider StdInChI 1S C9H13N3O5 c10 5 1 2 12 9 16 11 5 8 7 15 6 14 4 3 13 17 8 h1 2,4,6 8,13 15H,3H2, H2,10,11,16 t4 ,6 ,7 ,8 m1 s1 StdInChIKey Ref stdinchicite correct chemspider StdInChIKey UHDGCWIWMRVCDJ XVFCMESISA N CASNo 65 46 3 CASNo Ref cascite correct CAS PubChem 6175 UNII Ref fdacite correct FDA UNII 5CSZ8459RP ChEBI Ref ebicite correct EBI ChEBI 17562 SMILES O C1 N C N C C N1 C H 2O C H C H O C H 2O CO MeSHName Cytidine Section2 Chembox Properties C 9 H 13 N 3 O 5 MolarMass 243.217 Appearance Density MeltingPt BoilingPt Solubility Section3 Chembox Hazards MainHazards FlashPt Autoignition Cytidine is a nucleoside molecule that is formed when cytosine is attached to a ribose ring also known as a ribofuranose via a N sub 1 sub glycosidic bond . Cytidine is a component of RNA . If cytosine is attached to a deoxyribose ring, it is known as a deoxycytidine . Dietary sources of cytidine Dietary sources of cytidine include foods with high RNA ribonucleic acid content, ref name Jonas cite journal author Jonas DA, Elmadfa I, Engel KH, et al. title Safety considerations of DNA in food journal Ann Nutr Metab. volume 45 issue 6 pages 235 54 year 2001 pmid 11786646 url http content.karger.com produktedb produkte.asp?typ fulltext&file anm45235 doi 10.1159 000046734 ref such as organ meats, Brewer s yeast, as well as pyrimidine rich food ...   more details



  1. Thymidine

    chembox Verifiedfields changed Watchedfields changed verifiedrevid 416414982 ImageFile Desoxythymidin.svg ImageSize IUPACName OtherNames Section1 Chembox Identifiers CASNo 50 89 5 CASNo Ref cascite correct CAS PubChem 1134 ChEMBL Ref ebicite changed EBI ChEMBL 52609 DrugBank Ref drugbankcite changed drugbank DrugBank DB04485 UNII Ref fdacite changed FDA UNII VC2W18DGKR SMILES CC1 CN C O NC1 O C2CC C O2 CO O MeSHName Thymidine Section2 Chembox Properties C 10 H 14 N 2 O 5 Appearance Density MeltingPt BoilingPt Solubility Section3 Chembox Hazards MainHazards FlashPt Autoignition Thymidine more precisely called deoxythymidine can also be labelled deoxyribosylthymine , and thymine deoxyriboside is a chemical Chemical compound compound , more precisely a pyrimidine nucleoside deoxynucleoside . Deoxythymidine is the DNA nucleoside T, which pairs with deoxyadenosine A in double stranded DNA. In cell biology it is used to cell synchronization synchronize the cells in S phase. Before the boom in thymidine use caused by the need for thymidine for the production of the antiretroviral drug Zidovudine azidothymidine AZT , much of the world s thymidine production came from herring sperm. ref cite title Enzymatic Production of 5 Methyluridine from Purine Nucleosides and Thymine by Erwinia carotovora AJ 2992 author Makoto Ishii, Hideyuki Shirae, Kenzo Yokozeko publisher Agricultural and Biological Chemistry ref Thymidine occurs almost exclusively in DNA but also occurs in the T arm T loop of tRNA . Structure and properties In its composition, deoxythymidine is a nucleoside composed of deoxyribose a pentose sugar joined to the pyrimidine base thymine . Deoxythymidine can be phosphorylated with one, two or three phosphoric acid groups, creating respectively dTMP, dTDP or dTTP deoxythymidine mono di or triphosphate . It exists in solid form as small white crystals or white crystalline Powder substance powder , has a molecular weight of 242.229 unified atomic mass unit u , and has a me ...   more details



  1. Phosphodiester bond

    Refimprove date August 2009 Image Phosphodiester Bond Diagram.svg thumb 200px Two phosphodiester bonds PO sub 4 sub sup 3 sup between three nucleotides one Thymine molecule T and two molecules of Adenine A . A phosphodiester bond is a group of strong covalent bond s between a phosphate group and two 5 carbon ring carbohydrate s pentose s over two ester bonds. Phosphodiester bonds are central to all known life, as they make up the backbone of each helical strand of DNA . In DNA and RNA , the phosphodiester bond is the linkage between the Directionality molecular biology 3 carbon atom of one sugar molecule and the Directionality molecular biology 5 carbon atom of another the sugar molecules being deoxyribose in DNA and ribose in RNA. Phosphodiester bonds are also found in O phosphonolipids phospholipids . It must be noted that in the image to the right, the deprotonated oxygen bears a formal charge of 1 Petrucci 2011 . ref cite web title Nomenclature of Lipids Phospholipids url http www.chem.qmul.ac.uk iupac lipid lip1n2.html p21 work IUPAC IUB Commission on Biochemical Nomenclature CBN accessdate 22 October 2011 ref The phosphate groups in the phosphodiester bond are negatively charged. Because the phosphate groups have a Equilibrium constant pK sub a sub near 0, they are negatively charged at pH 7. This repulsion forces the phosphates to take opposite sides of the DNA strands and is neutralized by proteins histones , metal ions such as Magnesium in biology Nucleic acids magnesium , and polyamine s. In order for the phosphodiester bond to be formed and the nucleotide s to be joined, the tri phosphate or di phosphate forms of the nucleotide building blocks are broken apart to give off energy required to drive the Enzyme enzyme catalyzed reaction. When a single phosphate or two phosphates known as pyrophosphate s break away and catalyze the reaction, the phosphodiester bond is formed. Citation needed date August 2009 Hydrolysis of phosphodiester bonds can be catalyzed ...   more details



  1. DNA extraction

    a deoxyribose sugar and therefore is specific for DNA. Under these conditions, the 2 deoxyribose ...   more details



  1. Sodium periodate

    has vicinal diols instead of DNA as deoxyribose does not have vicinal diols. inorganic compound stub ...   more details



  1. Depurination

    In molecular genetics , depurination is an alteration of DNA in which the purine base adenine or guanine is removed from the deoxyribose sugar by hydrolysis of the beta N glycosidic bond glycosidic link between them. After depurination, an apurinic site is formed where the sugar phosphate backbone remains and the sugar ring has a hydroxyl OH group in the place of the purine. Studies estimate that as many as 5,000 purines are lost this way each day in a typical human cell. ref name instability cite journal last Lindahl first T. date 22 April 1993 title Instability and decay of the primary structure of DNA journal Nature journal Nature volume 362 issue 6422 pages 709 715 issn 0028 0836 doi 10.1038 362709a0 pmid 8469282 url http www.nature.com nature journal v362 n6422 abs 362709a0.html ref One of the main causes of depurination is the presence of endogenous metabolites in cell undergoing chemical reactions. Depurinated bases in double stranded DNA are efficiently repaired by portions of the base excision repair BER pathway. Depurinated bases in single stranded DNA undergoing DNA replication replication can lead to mutations , because in the absence of information from the complementary strand, BER can add an incorrect base at the apurinic site, resulting in either a Transition genetics transition or transversion mutation. ref cite web last Carr first Steven M. date 2009 title Depurination produces transversion mutations work http www.mun.ca biology scarr Directory.html www.mun.ca biology scarr publisher Memorial University of Newfoundland url http www.mun.ca biology scarr Depurination transversion.html accessdate 2010 08 19 ref Loss of pyrimidine bases Cytosine and Thymine occurs by a similar mechanism, but at a substantially lower rate. Hydrolytic depurination is one of the principal forms of damage to ancient DNA in fossil or subfossil material, since the base remains unrepaired. This results in both loss of information the base sequence , and difficulties in recove ...   more details



  1. Activation-induced (cytidine) deaminase

    by apurinic endonuclease APE creating a break in the deoxyribose phosphate backbone. This break ...   more details



  1. Alex Stokes

    Single strand DNA discovery Alexander Alec Rawson Stokes , 27 June 1919 Macclesfield 5 February 2003 was a co author of one ref Molecular Structure of Deoxypentose Nucleic Acids. by M H F Wilkins, A R Stokes and H R Wilson in Nature 1953 volume 171 pages 738 740. monograph http www.nature.com nature dna50 wilkins.pdf ref of the three papers published sequentially in Nature in March 1953 ref http www.nature.com nature dna50 archive.html Nature Archive. Double Helix 50 years of DNA ref announcing the presumed molecular structure of DNA. The first was authored by Francis Crick and James Watson ref A Structure for Deoxyribose Nucleic Acid. J D Watson and F H C Crick, Nature 171, 737 738 1953 http www.nature.com nature dna50 watsoncrick.pdf ref , and the third by Rosalind Franklin and Raymond Gosling ref Molecular Configuration in Sodium Thymonucleate. Franklin R. and Gosling R.G. Nature 171, 740 741 1953 http www.nature.com nature dna50 franklingosling.pdf ref . The Nobel Prize in Medicine was awarded in 1962 to Crick, Watson and Wilkins for this work. In 1993, on the 40th anniversary of the publication of the molecular structure of DNA, a plaque was erected in the Quad courtyard of the Strand campus of King s College London commemorating the contributions of Franklin, Gosling, Stokes, Wilson and Wilkins to DNA X ray diffraction studies . Education He received a first class degree in the natural science tripos in 1940 at Trinity College Cambridge and then researched X ray crystallography of Imperfect Crystals for his PhD in 1943 at the Cavendish Laboratory . He lectured in physics at Royal Holloway College, London before joining John Randall physicist John Randall s Biophysics Research Unit at King s College London in 1947. He has been credited ref http www.telegraph.co.uk news obituaries 1423280 Alexander Stokes.html Daily Telegraph Obituaries. 28 Feb 2003 ref as being the first person to demonstrate that the DNA molecule was probably helical in shape. Maurice Wilkins ...   more details



  1. T4 rII system

    The T4 r II system is an experimental system developed in the 1950s by Seymour Benzer for studying the substructure of the gene . The experimental system is based on genetic cross es of different mutant strain biology strains of bacteriophage T4 , a virus that infects the bacteria E. coli . Origin One type of mutation in T4 bacteriophage identified by researchers in phage genetics by the 1950s was known r for rapid , which caused the phage to destroy bacteria more quickly than normal. These could be spotted easily because they would produce larger viral plaque plaques rather than the smaller plaques characteristic of the wild type virus. Through genetic mapping , these phage workers had identified specific regions in the T4 chromosome, called the r I, r II, and r III Locus genetics loci , associated with the r mutants. In 1952, while performing experiments with r II mutants, Seymour Benzer found a strain that did not behave normally. By 1953, after the publication of Watson and Crick s Molecular Structure of Nucleic Acids A Structure for Deoxyribose Nucleic Acid proposed structure of DNA , Benzer hit on the idea that the apparently defective r mutants might have been the result of crossing two different r II mutants, each of which had part of the r II gene intact, so that hybrid strain did not exhibit the r phenotype at all because it combined the intact parts of the r II gene. ref Weiner, p. 52. ref From there, Benzer saw that it would be possible to generate many independent r mutants, and by measuring the recombination frequency between different r strains, he could map the substructure of a single gene. Although the chance of successful recombination for any given virus was very small, a single petri dish could be the basis for millions of trials at once. They could be screened easily by using a specific strain of E. coli , known as K12 , that was susceptible to wild type T4 but not to r mutants. ref Jayaraman, p. 903 ref Benzer s concept was quite controversi ...   more details



  1. Synthesis of nucleosides

    right padding right 50px padding top 30px 8 span center File NucleoScope4.png center Deoxyribose derived ...   more details



  1. Nucleic acid

    is the nucleotide , each of which contains a pentose sugar ribose or deoxyribose , a phosphate group ... contains 2 deoxyribose while RNA contains ribose where the only difference is the presence of a hydroxyl ... of nucleic acids a structure for deoxyribose nucleic acid journal Nature volume 171 issue 4356 pages ...   more details



  1. Uridine

    chembox Verifiedfields changed Watchedfields changed verifiedrevid 459510448 ImageFile Uridin.svg ImageSize 150px IUPACName 1 3R,4S,5R 3,4 dihydroxy 5 hydroxymethyl oxolan 2 yl pyrimidine 2,4 dione OtherNames uridine Section1 Chembox Identifiers CASNo 58 96 8 CASNo Ref cascite correct CAS PubChem ChEMBL Ref ebicite changed EBI ChEMBL 100259 DrugBank Ref drugbankcite correct drugbank DrugBank DB02745 UNII Ref fdacite correct FDA UNII WHI7HQ7H85 SMILES O C1NC O N C C1 C H 2O C H CO C H O C H 2O MeSHName Uridine Section2 Chembox Properties C 9 H 12 N 2 O 6 MolarMass 244.20 Appearance Density MeltingPt BoilingPt Solubility Section3 Chembox Hazards MainHazards FlashPt Autoignition Uridine is a molecule known as a nucleoside that is formed when uracil is attached to a ribose ring also known as a ribofuranose via a N sub 1 sub glycosidic bond . If uracil is attached to a deoxyribose ring, it is known as a deoxyuridine . Dietary sources of uridine Uridine is one of the four basic components of ribonucleic acid RNA the other three are adenosine , guanosine , and cytidine . Upon digestion of foods containing RNA, uridine is released from RNA and is absorbed intact in the gut. Some food sources of uridine are Sugarcane extract ref http www.thebody.com content art30244.html Thebody.com ref Tomatoes 0.5 to 1.0 g uridine per kilogram dry weight ref http www.aseanfood.info Articles 11018411.pdf Aseanfood.info ref Brewer s yeast 3 uridine by dry weight ref name pmid11786646 cite journal author Jonas DA, Elmadfa I, Engel KH, Heller KJ, Kozianowski G, K nig A, M ller D, Narbonne JF, Wackernagel W, Kleiner J title Safety considerations of DNA in food journal Ann Nutr Metab volume 45 issue 6 pages 235 54 year 2001 pmid 11786646 doi 10.1159 000046734 url ref Beer ref name pmid12370853 cite journal author Yamamoto T, Moriwaki Y, Takahashi S, Tsutsumi Z, Ka T, Fukuchi M, Hada T title Effect of beer on the plasma concentrations of uridine and purine bases journal Metab Clin Exp volume 51 ...   more details



  1. Kinetin

    to be via the production of furfural an oxidative damage product of deoxyribose sugar in DNA ...   more details



  1. Triple-stranded DNA

    for deoxyribose nucleic acid. Nature, 4356 737 738. Firulli, A, Maibenco, D., and Kinniburgh ...   more details



  1. Directionality (molecular biology)

    Image Nukleotid num.svg thumb A furanose sugar ring molecule with carbon atoms labeled using standard notation. The 5 is upstream the 3 is downstream. DNA and RNA are synthesized in the 5 to 3 direction. Directionality , in molecular biology and biochemistry , is the end to end chemical orientation of a single strand of nucleic acid . The chemical convention of naming carbon atoms in the nucleotide Furanose sugar ring numerically gives rise to a 5&prime end and a 3&prime end usually pronounced five prime end and three prime end . The relative positions of structures along a strand of nucleic acid, including gene s and various protein binding site s, are usually noted as being either upstream towards the 5&prime end or downstream towards the 3&prime end . This naming convention is important because nucleic acids can only be synthesized in vivo in a 5&prime to 3&prime direction, because the polymerase used to assemble new strands must attach a new nucleotide to the 3&prime hydroxyl OH group via a phosphodiester bond . By convention, single strands of DNA and RNA sequences are written in 5&prime to 3&prime direction. 5&prime end Several pages directly link to this sub heading The 5&prime end pronounced five prime end designates the end of the DNA or RNA strand that has the fifth carbon in the Furanose sugar ring of the deoxyribose or ribose at its terminus. A phosphate group attached to the 5&prime end permits DNA ligase ligation of two nucleotide s, i.e., the covalent binding of a 5&prime phosphate to the 3 hydroxyl group of another nucleotide, to form a phosphodiester bond . Removal of the 5&prime phosphate prevents ligation. To prevent unwanted nucleic acid ligation e.g. self ligation of a plasmid plasmid vector in DNA cloning , Molecular biology molecular biologists commonly remove the 5&prime phosphate with a phosphatase . The 5&prime end of nascent messenger RNA is the site at which 5 cap post transcriptional capping occurs, a process which is vital to producing ...   more details



  1. Odile Crick

    Odile Crick August 11, 1920 &ndash July 5, 2007 was a British artist best known for her drawing of the double helix structure of DNA discovered by her husband Francis Crick and James D. Watson in 1953. ref http www.nytimes.com 2007 07 30 science 30crick.html?ex 1343448000&en f0da434e0cc6404b&ei 5088&partner rssnyt&emc rss New York Times Odile Crick, Who Drew Iconic Double Helix, Dies at 86 July 30, 2007 ref Early life Odile Crick was born as Odile Speed in King s Lynn , Norfolk , England , to a French mother, Marie Therese Josephine Jaeger and an English father, Alfred Valentine Speed, who was a jeweller. ref http www.nytimes.com 2007 07 30 science 30crick.html?ex 1343448000&en f0da434e0cc6404b&ei 5088&partner rssnyt&emc rss New York Times Odile Crick, Who Drew Iconic Double Helix, Dies at 86 July 30, 2007 ref She was an art student in Vienna when the Nazi s occupied Austria in 1938. Speed joined the Womens Royal Naval Service WRNS as a lorry driver. However, her skills in German language German led to work as a code breaker and translator at the Admiralty where she met Francis Crick in 1945. ref http news.independent.co.uk people obituaries article2785431.ece The Independent Odile Crick 20 July 2007 ref After the war, she finished her art studies at Central Saint Martins College of Art and Design St. Martin s in London . Life with Crick in Britain The Cricks married in 1949 and lived in Cambridge . Odile Crick worked as a teacher at what is now Anglia Ruskin University before the births of their daughters Gabrielle on 15 July 1951 and Jacqueline on 12 March 1954. ref http news.independent.co.uk people obituaries article2785431.ece The Independent Odile Crick 20 July 2007 ref Crick and Watson asked her to draw an illustration of the double helix for their paper on DNA for Nature journal Nature in 1953. ref http www.ncbi.nlm.nih.gov sites entrez?Db pubmed&Cmd ShowDetailView&TermToSearch 13054692&ordinalpos 12 Molecular structure of nucleic acids a structure for deoxy ...   more details




Articles 26 - 50 of 129      Previous     Next


Search   in  
Search for deoxyribose in Tutorials
Search for deoxyribose in Encyclopedia
Search for deoxyribose in Videos
Search for deoxyribose in Books
Search for deoxyribose in Software
Search for deoxyribose in DVDs
Search for deoxyribose in Store


Advertisement




deoxyribose in Encyclopedia
deoxyribose top deoxyribose

Home - Add TutorGig to Your Site - Disclaimer

©2011-2013 TutorGig.info All Rights Reserved. Privacy Statement